We are using technical cookies that are necessary for page to work correctly.

tdbR00000333

NameValue
Coding AA: Gln
Anticodon sequence: $UG
Organism: Escherichia coli NCBI:txid562
RNA type: cytoplasmic
Sequence: UGGGGUA4CGCCAAGC#GDAAGGCACCGGUJU$UG/PACCGGCAUUCCCUGGTPCGAAUCCAGGUACCCCAGCCA
Unmodified sequence: UGGGGUAUCGCCAAGCGGUAAGGCACCGGUUUUUGAUACCGGCAUUCCCUGGUUCGAAUCCAGGUACCCCAGCCA
Secondary structure: (((((((..(((.........))).(((((.......))))).....(((((.......))))))))))))....
Homology model or
structure extracted from PDB:
Model Download (by RNA Composer) (last update July 2, 2025)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Aug. 26, 2026
Folding free energy [kcal/mol]: -28.10
Pre-aligned sequence:
Pre-aligned secondary structure:
-UGGGGUA4CGCCAAGC--#GD--AAGGCACCGGUJUNUG/PACCGGCA-------------------UUCCCUGGTPCGAAUCCAGGUACCCCAGCCA
.(((((((..(((.............))).(((((.......)))))........................(((((.......))))))))))))....
Publications:
  • The nucleotide sequences of the two glutamine transfer ribonucleic acids from Escherichia coli.
    M Yaniv, W R Folk
    The Journal of biological chemistry
    volume: 250 issue: 9 date: May 10, 1975 PUBMED ID: 164464
  • The output of the tRNA modification pathways controlled by the Escherichia coli MnmEG and MnmC enzymes depends on the growth conditions and the tRNA species.
    Ismaïl Moukadiri, M-José Garzón, Glenn R Björk, M-Eugenia Armengod
    Nucleic acids research
    volume: 42 issue: 4 epub: Nov. 30, 2013 PUBMED ID: 24293650 DOI: 10.1093/nar/gkt1228

Aminoacylation

NameValue
Positive identity elements regulating aminoacylation: G73; U1-A72; G2-C71; G3-C70; G10; U34; U35; G36; A37; U38
Negative identity elements antideterminants of aminoacylation: NA
Citation: Rogers,M.J., Adachi,T., Inokuchi,H. and S¨oll,D. (1992) Switching tRNAGln identity from glutamine to tryptophan. Proc. Natl Acad. Sci. USA, 89, 3463–3467.
DOI: 10.1073/pnas.89.8.3463
PMID: 1565639

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
RNA Composer