We are using technical cookies that are necessary for page to work correctly.

tdbR00000119

NameValue
Coding AA: Gly
Anticodon sequence: {CC
Organism: Escherichia coli NCBI:txid562
RNA type: cytoplasmic
Sequence: GCGGGCAUCGUAUAAUGGCUAUUACCUCAGCCU{CCAAGCUGAUGAUGCGGGTPCGAUUCCCGCUGCCCGCUCCA
Unmodified sequence: GCGGGCAUCGUAUAAUGGCUAUUACCUCAGCCUUCCAAGCUGAUGAUGCGGGUUCGAUUCCCGCUGCCCGCUCCA
Secondary structure: (((((((..(((..........))).(((((.......)))))....(((((.......))))))))))))....
Homology model or
structure extracted from PDB:
Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: July 2, 2025
Folding free energy [kcal/mol]: -27.50
Pre-aligned sequence:
Pre-aligned secondary structure:
-GCGGGCAUCGUAUAAU--GGCU-AUUACCUCAGCCUNCCAAGCUGAUG-------------------A-UGCGGGTPCGAUUCCCGCUGCCCGCUCCA
.(((((((..(((.............))).(((((.......)))))........................(((((.......))))))))))))....
Publications:
  • The output of the tRNA modification pathways controlled by the Escherichia coli MnmEG and MnmC enzymes depends on the growth conditions and the tRNA species.
    Ismaïl Moukadiri, M-José Garzón, Glenn R Björk, M-Eugenia Armengod
    Nucleic acids research
    volume: 42 issue: 4 epub: Nov. 30, 2013 PUBMED ID: 24293650 DOI: 10.1093/nar/gkt1228
  • Nucleotide sequence studies of normal and genetically altered glycine transfer ribonucleic acids from Escherichia coli.
    J W Roberts, J Carbon
    The Journal of biological chemistry
    volume: 250 issue: 14 date: July 25, 1975 PUBMED ID: 167016
Comments: 34 N IS A MODIFIED U

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
Moderna
RNA Composer