We are using technical cookies that are necessary for page to work correctly.

tdbR00000158 (deprecated)

NameValue
Coding AA: Ile
Anticodon sequence: GAU
Organism: Escherichia coli NCBI:txid562
RNA type: cytoplasmic
Sequence: AGGCUUGUAGCUCAGGDGGDDAGAGCGCACCCCUGAU6AGGGUGAG7XCGGUGGTPCAAGUCCACPCAGGCCUACCA
Unmodified sequence: AGGCUUGUAGCUCAGGUGGUUAGAGCGCACCCCUGAUAAGGGUGAGGUCGGUGGUUCAAGUCCACUCAGGCCUACCA
Secondary structure: (((((((..((((.........)))).(((((.......))))).....(((((.......))))))))))))....
Homology model or
structure extracted from PDB:
Model Download (by RNA Composer) (last update July 2, 2025)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Aug. 17, 2026
Folding free energy [kcal/mol]: -25.80
Pre-aligned sequence:
Pre-aligned secondary structure:
-AGGCUUGUAGCUCAGGD-GGDD-AGAGCGCACCCCUGAU6AGGGUGAG-------------------7XCGGUGGTPCAAGUCCACPCAGGCCUACCA
.(((((((..((((...........)))).(((((.......)))))........................(((((.......))))))))))))....
Publications:
  • The sequence of nucleotides in tRNA Ile from E. coli B.
    M Yarus, B G Barrell
    Biochemical and biophysical research communications
    volume: 43 issue: 4 date: May 21, 1971 PUBMED ID: 4935283
Next entry: tdbR00000158 (Aug. 26, 2026, 4:23 p.m.)

Aminoacylation

NameValue
Positive identity elements regulating aminoacylation: A73; C4-G69; U12-A23; G16; D20; D21; C29-G41; L/k2C34 or C/G34 context; A35; U36; t6A37; A38
Negative identity elements antideterminants of aminoacylation: L/k2C34 is also an antideterminant preventing MetRS recognition/decoding as Met; unmodified C34 impairs Ile identity and can confer Met activity.
Citation: Thiaville,P.C., El Yacoubi,B., K¨ohrer,C., Thiaville,J.J., Deutsch,C., Iwata-Reuyl,D., Bacusmo,J.M., Armengaud,J., Bessho,Y., Wetzel,C. et al. (2015) Essentiality of threonylcarbamoyladenosine (t6A), a universal tRNA modification, in bacteria. Mol. Microbiol., 98, 1199–1221.
DOI: 10.1111/mmi.13209
PMID: 26337258

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
RNA Composer