tdbR00000158
| Name | Value |
|---|---|
| Coding AA: | Ile |
| Anticodon sequence: | GAU |
| Organism: | Escherichia coli NCBI:txid562 |
| RNA type: | cytoplasmic |
| Sequence: | AGGCUUGUAGCUCAGGDGGDDAGAGCGCACCCCUGAU6AGGGUGAG7XCGGUGGTPCAAGUCCACPCAGGCCUACCA |
| Unmodified sequence: | AGGCUUGUAGCUCAGGUGGUUAGAGCGCACCCCUGAUAAGGGUGAGGUCGGUGGUUCAAGUCCACUCAGGCCUACCA |
| Secondary structure: | (((((((..((((.........)))).(((((.......))))).....(((((.......)))))))))))).... |
| Homology model or structure extracted from PDB: |
Model Download (by RNA Composer) (last update July 2, 2025) |
| Prepared by: | Database creators |
| Version: | 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: June 29, 2026 |
| Folding free energy [kcal/mol]: | -25.80 |
| Pre-aligned sequence: Pre-aligned secondary structure: |
-AGGCUUGUAGCUCAGGD-GGDD-AGAGCGCACCCCUGAU6AGGGUGAG-------------------7XCGGUGGTPCAAGUCCACPCAGGCCUACCA .(((((((..((((...........)))).(((((.......)))))........................(((((.......)))))))))))).... |
| Publications: |
|
Aminoacylation
| Name | Value |
|---|---|
| Positive identity elements regulating aminoacylation: | A73; C4-G69; U12-A23; G16; D20; D21; C29-G41; L/k2C34 or C/G34 context; A35; U36; t6A37; A38 |
| Negative identity elements antideterminants of aminoacylation: | L/k2C34 is also an antideterminant preventing MetRS recognition/decoding as Met; unmodified C34 impairs Ile identity and can confer Met activity. |
| Citation: | Thiaville,P.C., El Yacoubi,B., K¨ohrer,C., Thiaville,J.J., Deutsch,C., Iwata-Reuyl,D., Bacusmo,J.M., Armengaud,J., Bessho,Y., Wetzel,C. et al. (2015) Essentiality of threonylcarbamoyladenosine (t6A), a universal tRNA modification, in bacteria. Mol. Microbiol., 98, 1199–1221. |
| DOI: | 10.1111/mmi.13209 |
| PMID: | 26337258 |
Secondary structure
Tertiary structure
Model based on:
