tdbR00000160

Name	Value
Coding AA:	Ile
Anticodon sequence:	}AU
Organism:	Escherichia coli NCBI:txid562
RNA type:	cytoplasmic
Sequence:	GGCCCCU4AGCUCAGU#GDDAGAGCAGGCGACU}AU6APCGCUUG7XCGCUGGTPCAAGUCCAGCAGGGGCCACCA
Unmodified sequence:	GGCCCCUUAGCUCAGUGGUUAGAGCAGGCGACUCAUAAUCGCUUGGUCGCUGGUUCAAGUCCAGCAGGGGCCACCA
Secondary structure:	(((((((..((((........))))((((((.......))))))....(((((.......))))))))))))....
Homology model or structure extracted from PDB:	Model Download (last update Sept. 6, 2019)
Prepared by:	Database creators
Version:	1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Sept. 23, 2019
Folding free energy [kcal/mol]:	-33.50
Pre-aligned sequence: Pre-aligned secondary structure:	-GGCCCCU4AGCUCAGU--#GDD-AGAGCAGGCGACU}AU6APCGCUUG-------------------7XCGCUGGTPCAAGUCCAGCAGGGGCCACCA .(((((((..((((...........))))((((((.......)))))).......................(((((.......))))))))))))....
Publications:	A novel lysine-substituted nucleoside in the first position of the anticodon of minor isoleucine tRNA from Escherichia coli. T Muramatsu, S Yokoyama, N Horie, A Matsuda, T Ueda, Z Yamaizumi, Y Kuchino, S Nishimura, T Miyazawa The Journal of biological chemistry volume: 263 issue: 19 date: July 5, 1988 PUBMED ID: 3132458 Primary structure of AUA-specific isoleucine transfer ribonucleic acid from Escherichia coli. Y Kuchino, S Watanabe, F Harada, S Nishimura Biochemistry volume: 19 issue: 10 date: May 13, 1980 PUBMED ID: 6990971
Comments:	18 PARTIALLY G