We are using technical cookies that are necessary for page to work correctly.

tdbR00000511 (deprecated)

NameValue
Coding AA: Ini
Anticodon sequence: CAU
Organism: Escherichia coli NCBI:txid562
RNA type: cytoplasmic
Sequence: CGCGGGG4GGAGCAGCCUGGDAGCUCGUCGGGBUCAUAACCCGAAG7UCGUCGGTPCAAAUCCGGCCCCCGCAACCA
Unmodified sequence: CGCGGGGUGGAGCAGCCUGGUAGCUCGUCGGGCUCAUAACCCGAAGGUCGUCGGUUCAAAUCCGGCCCCCGCAACCA
Secondary structure: .((((((..((((.........)))).(((((.......))))).....(((((.......))))))))))).....
Homology model or
structure extracted from PDB:
Model Download (by RNA Composer) (last update July 2, 2025)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Aug. 17, 2026
Folding free energy [kcal/mol]: -30.30
Pre-aligned sequence:
Pre-aligned secondary structure:
-CGCGGGG4GGAGCAGCCUGGD--AGCUCGUCGGGBUCAUAACCCGAAG-------------------7UCGUCGGTPCAAAUCCGGCCCCCGCAACCA
..((((((..((((...........)))).(((((.......)))))........................(((((.......))))))))))).....
Publications:
  • The nucleotide sequence of N-formyl-methionyl-transfer RNA. Partial digestion with pancreatic and T-1 ribonuclease and derivation of the total primary structure.
    S K Dube, K A Marcker
    European journal of biochemistry
    volume: 8 issue: 2 PUBMED ID: 4889178
Next entry: tdbR00000511 (Aug. 17, 2026, 11:33 a.m.)

Aminoacylation

NameValue
Positive identity elements regulating aminoacylation: Initiator Met identity: CAU anticodon C34-A35-U36; initiator-specific acceptor/anticodon-loop context including C32/U33/A37 and formylation-related elements
Negative identity elements antideterminants of aminoacylation: NA
Citation: Pak,M., Pallanck,L. and Schulman,L.H. (1992) Conversion of a methionine initiator tRNA into a tryptophan-inserting elongator tRNA in vivo. Biochemistry, 31, 3303–3309.
DOI: 10.1021/bi00128a001
PMID: 1554714

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
RNA Composer