tdbR00000221 (deprecated)

Name	Value
Coding AA:	Leu
Anticodon sequence:	CAG
Organism:	Escherichia coli NCBI:txid562
RNA type:	cytoplasmic
Sequence:	GCGAAGGUGGCGGAADD#GDAGACGCGCUAGCUUCAG;PGPUAGUGUCCUUACGGACGUGGGGGTPCAAGUCCCCCCCCUCGCACCA
Unmodified sequence:	GCGAAGGUGGCGGAAUUGGUAGACGCGCUAGCUUCAGGUGUUAGUGUCCUUACGGACGUGGGGGUUCAAGUCCCCCCCCUCGCACCA
Secondary structure:	((((.((..(((...........)))((((((.......))))))..............(((((.......))))))).))))....
Homology model or structure extracted from PDB:	Model Download (last update Sept. 6, 2019)
Prepared by:	Database creators
Version:	1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: April 29, 2020
Folding free energy [kcal/mol]:	-25.60
Pre-aligned sequence: Pre-aligned secondary structure:	-GCGAAGGUGGCGGAADD-#GDA-GACGCGCUAGCUUCAG;PGPUAGU-GUCC---UUAC----GGACG-UGGGGGTPCAAGUCCCCCCCCUCGCACCA .((((.((..(((.............)))((((((.......)))))).......................(((((.......))))))).))))....
Publications:	The nucleotide sequence of two leucine tRNA species from Escherichia coli K12. H U Blank, D Söll Biochemical and biophysical research communications volume: 43 issue: 5 date: June 4, 1971 PUBMED ID: 4936129 Purification, characterization and cytotoxic activities of individual tRNAs from Escherichia coli KY Cao, Y Pan, TM Yan, ZH Jiang International journal of biological macromolecules volume: 142:355-365 date: Jan. 1, 2020 epub: Oct. 5, 2019 PUBMED ID: 31593735 DOI: 10.1016/j.ijbiomac.2019.09.106
Next entry:	tdbR00000221 (April 29, 2020, 7:46 p.m.)