tdbR00000220

NameValue
Coding AA: Leu
Anticodon sequence: )AA
Organism: Escherichia coli NCBI:txid562
RNA type: cytoplasmic
Sequence: GCCCGGA4GGUGGAADC#GDAGACACAAGGGAPU)AA*APCCCUCGGCGUUCGCGCUGUGCGGGTPCAAGUCCCGCUCCGGGUACCA
Unmodified sequence: GCCCGGAUGGUGGAAUCGGUAGACACAAGGGAUUAAAAAUCCCUCGGCGUUCGCGCUGUGCGGGUUCAAGUCCCGCUCCGGGUACCA
Secondary structure: (((((((..(((...........))).(((((.......)))))...............(((((.......))))))))))))....
PDB ID: 3gz, 5onh, 5on2, 5on3, 5onw, 2nqp, 3zjt, 3zju, 4aq7, 4arc, 4ari, 4as1, 4cnq
Homology model or
structure extracted from PDB:
Extracted Download (last update Sept. 6, 2019)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Sept. 23, 2019
Folding free energy [kcal/mol]: -28.20
Pre-aligned sequence:
Pre-aligned secondary structure:
-GCCCGGA4GGUGGAADC-#GDA-GACACAAGGGAPUHAA*APCCCUC-GGCG---UUCG----CGCUG-UGCGGGTPCAAGUCCCGCUCCGGGUACCA
.(((((((..(((.............))).(((((.......)))))........................(((((.......))))))))))))....
Publications:
  • Primary structure of Escherichia coli tRNA UUR Leu. Presence of an unknown adenosine derivative in the first position of the anticodon which recognizes the UU codon series.
    Z Yamaizumi, Y Kuchino, F Harada, S Nishimura, J A McCloskey
    The Journal of biological chemistry
    volume: 255 issue: 5 date: March 10, 1980 PUBMED ID: 6986390
  • YibK is the 2'-O-methyltransferase TrmL that modifies the wobble nucleotide in Escherichia coli tRNA(Leu) isoacceptors.
    Alfonso Benítez-Páez, Magda Villarroya, Stephen Douthwaite, Toni Gabaldón, M-Eugenia Armengod
    RNA (New York, N.Y.)
    volume: 16 issue: 11 epub: Sept. 20, 2010 PUBMED ID: 20855540 DOI: 10.1261/rna.2245910
Your browser does not support the canvas element.