We are using technical cookies that are necessary for page to work correctly.

tdbR00000391

NameValue
Coding AA: Ser
Anticodon sequence: GCU
Organism: Escherichia coli NCBI:txid562
RNA type: cytoplasmic
Sequence: GGUGAGG4GGCCGAGAGGCDGAAGGCGCUCCC%UGCU6AGGGAGUAUGCGGUCAAAAGCUGCAUCCGGGGTPCGAAUCCCCGCCUCACCGCCA
Unmodified sequence: GGUGAGGUGGCCGAGAGGCUGAAGGCGCUCCCCUGCUAAGGGAGUAUGCGGUCAAAAGCUGCAUCCGGGGUUCGAAUCCCCGCCUCACCGCCA
Secondary structure: (((((((..(((...........)))((((((.......))))))....................(((((.......))))))))))))....
Homology model or
structure extracted from PDB:
Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: June 29, 2026
Folding free energy [kcal/mol]: -34.00
Pre-aligned sequence:
Pre-aligned secondary structure:
-GGUGAGG4GGCCGAGA--GGCDGAAGGCGCUCCC%UGCU6AGGGAGU-AUGCGGUCAAAAGCUGCAU--CCGGGGTPCGAAUCCCCGCCUCACCGCCA
.(((((((..(((.............)))((((((.......)))))).......................(((((.......))))))))))))....
Variants & Diseases:
Publications:
  • Nucleotide sequence of tRNA(Ser)(3) from Escherichia coli.
    Y Yamada, H Ishikura
    FEBS letters
    volume: 29 issue: 3 date: Feb. 1, 1973 PUBMED ID: 11946920
  • The nucleotide sequence of a serine transfer ribonucleic acid from Escherichia coli.
    D Ish-Horowicz, B F Clark
    The Journal of biological chemistry
    volume: 248 issue: 19 date: Oct. 10, 1973 PUBMED ID: 4355500

Aminoacylation

NameValue
Positive identity elements regulating aminoacylation: G73; C72; G2-C71; R4-Y69; C11-G24; large variable arm; G30-C40
Negative identity elements antideterminants of aminoacylation: Anticodon is not a major determinant; anticodon changes can lead to mistranslation because serylation is retained.
Citation: Asahara,H., Himeno,H., Tamura,K., Nameki,N., Hasegawa,T. and Shimizu,M. (1994) Escherichia coli seryl-tRNA synthetase recognizes tRNASer by its characteristic tertiary structure. J. Mol. Biol., 236, 738–748.
DOI: 10.1006/jmbi.1994.1186
PMID: 8114091

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
Moderna
RNA Composer