tdbR00000392
| Name | Value |
|---|---|
| Coding AA: | Ser |
| Anticodon sequence: | GGA |
| Organism: | Escherichia coli NCBI:txid562 |
| RNA type: | cytoplasmic |
| Sequence: | GGUGAGGUGUCCGAGU#GCDGAAGGAGCACGCCUGGAAAGPGUGUAUACGGCAACGUAUCGGGGGTPCGAAUCCCCCCCUCACCGCCA |
| Unmodified sequence: | GGUGAGGUGUCCGAGUGGCUGAAGGAGCACGCCUGGAAAGUGUGUAUACGGCAACGUAUCGGGGGUUCGAAUCCCCCCCUCACCGCCA |
| Secondary structure: | (((((((..(((...........)))((((((.......))))))...............(((((.......)))))))))))).... |
| Homology model or structure extracted from PDB: |
Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025) |
| Prepared by: | Database creators |
| Version: | 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: June 29, 2026 |
| Folding free energy [kcal/mol]: | -30.20 |
| Pre-aligned sequence: Pre-aligned secondary structure: |
-GGUGAGGUGUCCGAGU--#GCDGAAGGAGCACGCCUGGAAAGPGUGU-AUACG--GCAA---CGUAU--CGGGGGTPCGAAUCCCCCCCUCACCGCCA .(((((((..(((.............)))((((((.......)))))).......................(((((.......)))))))))))).... |
| Variants & Diseases: | |
| Publications: |
|
Aminoacylation
| Name | Value |
|---|---|
| Positive identity elements regulating aminoacylation: | G73; C72; G2-C71; R4-Y69; C11-G24; large variable arm; G30-C40 |
| Negative identity elements antideterminants of aminoacylation: | Anticodon is not a major determinant; anticodon changes can lead to mistranslation because serylation is retained. |
| Citation: | Asahara,H., Himeno,H., Tamura,K., Nameki,N., Hasegawa,T. and Shimizu,M. (1994) Escherichia coli seryl-tRNA synthetase recognizes tRNASer by its characteristic tertiary structure. J. Mol. Biol., 236, 738–748. |
| DOI: | 10.1006/jmbi.1994.1186 |
| PMID: | 8114091 |
Secondary structure
Tertiary structure
Model based on:
