We are using technical cookies that are necessary for page to work correctly.

tdbR00000393 (deprecated)

NameValue
Coding AA: Ser
Anticodon sequence: GGA
Organism: Escherichia coli NCBI:txid562
RNA type: cytoplasmic
Sequence: GGUGAGG4GUCCGAGU#GDDGAAGGAGCACGCCUGGAAAGPGUGUAUACGGCAACGUAUCGGGGGTPCGAAUCCCCCCCUCACCGCCA
Unmodified sequence: GGUGAGGUGUCCGAGUGGUUGAAGGAGCACGCCUGGAAAGUGUGUAUACGGCAACGUAUCGGGGGUUCGAAUCCCCCCCUCACCGCCA
Secondary structure: (((((((..(((...........)))((((((.......))))))...............(((((.......))))))))))))....
Homology model or
structure extracted from PDB:
Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Aug. 17, 2026
Folding free energy [kcal/mol]: -30.20
Pre-aligned sequence:
Pre-aligned secondary structure:
-GGUGAGG4GUCCGAGU--#GDDGAAGGAGCACGCCUGGAAAGPGUGU-AUACG--GCAA---CGUAU--CGGGGGTPCGAAUCCCCCCCUCACCGCCA
.(((((((..(((.............)))((((((.......)))))).......................(((((.......))))))))))))....
Publications:
  • Nucleotide sequences of two serine tRNAs with a GGA anticodon: the structure-function relationships in the serine family of E. coli tRNAs.
    H Grosjean, K Nicoghosian, E Haumont, D Söll, R Cedergren
    Nucleic acids research
    volume: 13 issue: 15 date: Aug. 12, 1985 PUBMED ID: 3898020
Next entry: tdbR00000393 (Aug. 26, 2026, 4:24 p.m.)

Aminoacylation

NameValue
Positive identity elements regulating aminoacylation: G73; C72; G2-C71; R4-Y69; C11-G24; large variable arm; G30-C40
Negative identity elements antideterminants of aminoacylation: Anticodon is not a major determinant; anticodon changes can lead to mistranslation because serylation is retained.
Citation: Asahara,H., Himeno,H., Tamura,K., Nameki,N., Hasegawa,T. and Shimizu,M. (1994) Escherichia coli seryl-tRNA synthetase recognizes tRNASer by its characteristic tertiary structure. J. Mol. Biol., 236, 738–748.
DOI: 10.1006/jmbi.1994.1186
PMID: 8114091

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
Moderna
RNA Composer