We are using technical cookies that are necessary for page to work correctly.

tdbR00000394 (deprecated)

NameValue
Coding AA: Ser
Anticodon sequence: VGA
Organism: Escherichia coli NCBI:txid562
RNA type: cytoplasmic
Sequence: GGAAGUG4GGCCGAGC#GDDGAAGGCACCGGUBUVGA*AACCGGCGACCCGAAAGGGUUCCAGAGTPCGAAUCUCUGCGCUUCCGCCA
Unmodified sequence: GGAAGUGUGGCCGAGCGGUUGAAGGCACCGGUCUUGAAAACCGGCGACCCGAAAGGGUUCCAGAGUUCGAAUCUCUGCGCUUCCGCCA
Secondary structure: (((((((..(((...........))).(((((.......)))))................(((((.......))))))))))))....
Homology model or
structure extracted from PDB:
Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Aug. 17, 2026
Folding free energy [kcal/mol]: -25.00
Pre-aligned sequence:
Pre-aligned secondary structure:
-GGAAGUG4GGCCGAGC--#GDDGAAGGCACCGGUBUVGA*AACCGGC-GACCC--GAAA---GGGUU--CCAGAGTPCGAAUCUCUGCGCUUCCGCCA
.(((((((..(((.............))).(((((.......)))))........................(((((.......))))))))))))....
Publications:
  • The nucleotide sequence of a serine tRNA from Escherichia coli.
    H Ishikura, Y Yamada, S Nishimura
    FEBS letters
    volume: 16 issue: 1 date: July 15, 1971 PUBMED ID: 11945903
  • Identification of a modified nucleoside in Escherichia coli tRNA1Ser as 2'-O-methylcytidine.
    Y Yamada, H Ishikura
    Biochimica et biophysica acta
    volume: 402 issue: 3 date: Sept. 1, 1975 PUBMED ID: 1100116
Next entry: tdbR00000394 (Aug. 26, 2026, 4:25 p.m.)

Aminoacylation

NameValue
Positive identity elements regulating aminoacylation: G73; C72; G2-C71; R4-Y69; C11-G24; large variable arm; G30-C40
Negative identity elements antideterminants of aminoacylation: Anticodon is not a major determinant; anticodon changes can lead to mistranslation because serylation is retained.
Citation: Asahara,H., Himeno,H., Tamura,K., Nameki,N., Hasegawa,T. and Shimizu,M. (1994) Escherichia coli seryl-tRNA synthetase recognizes tRNASer by its characteristic tertiary structure. J. Mol. Biol., 236, 738–748.
DOI: 10.1006/jmbi.1994.1186
PMID: 8114091

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
Moderna
RNA Composer