We are using technical cookies that are necessary for page to work correctly.

tdbR00000456

NameValue
Coding AA: Val
Anticodon sequence: VAC
Organism: Escherichia coli NCBI:txid562
RNA type: cytoplasmic
Sequence: GGGUGAU4AGCUCAGCDGGGAGAGCACCUCCCUVAC=AGGAGGGG7UCGGCGGTPCGAUCCCGUCAUCACCCACCA
Unmodified sequence: GGGUGAUUAGCUCAGCUGGGAGAGCACCUCCCUUACAAGGAGGGGGUCGGCGGUUCGAUCCCGUCAUCACCCACCA
Secondary structure: (((((((..((((........)))).(((((.......))))).....(((((.......))))))))))))....
Homology model or
structure extracted from PDB:
Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: June 29, 2026
Folding free energy [kcal/mol]: -29.80
Pre-aligned sequence:
Pre-aligned secondary structure:
-GGGUGAU4AGCUCAGCD-GGG--AGAGCACCUCCCUVAC=AGGAGGGG-------------------7UCGGCGGTPCGAUCCCGUCAUCACCCACCA
.(((((((..((((...........)))).(((((.......)))))........................(((((.......))))))))))))....
Variants & Diseases:
Publications:
  • Primary sequence of tRNA-Val-1 from Escherichia coli B. II. Isolation of large fragments by limited digestion with RNases, and overlapping of fragments to reduce the total primary sequence.
    F Kimura, F Harada, S Nishimura
    Biochemistry
    volume: 10 issue: 17 date: Aug. 17, 1971 PUBMED ID: 5000876
  • Purification, characterization and cytotoxic activities of individual tRNAs from Escherichia coli.
    Kai-Yue Cao, Yu Pan, Tong-Meng Yan, Zhi-Hong Jiang
    International journal of biological macromolecules
    volume: 142 date: Jan. 1, 2020 epub: Oct. 5, 2019 PUBMED ID: 31593735 DOI: 10.1016/j.ijbiomac.2019.09.106

Aminoacylation

NameValue
Positive identity elements regulating aminoacylation: A73; G3-C70; U4-A69; A35; C36; G20; G45
Negative identity elements antideterminants of aminoacylation: Efficient mischarging of tRNAIle and tRNAMet by ValRS reflects overlap of A73/A35 identity features.
Citation: Tardif,K.D. and Horowitz,J. (2004) Functional group recognition at the aminoacylation and editing sites of E. coli valyl-tRNA synthetase. RNA, 10, 493–503.
DOI: 10.1261/rna.5166704
PMID: 14970394

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
Moderna
RNA Composer