tdbR00000364

Name	Value
Coding AA:	Arg
Anticodon sequence:	ACG
Organism:	Ascaris suum NCBI:txid6253
RNA type:	mitochondrial
Sequence:	GGACGUU""AUAGAUAAGCUAPGCCPAGPUACGKQCPGGGAAGAGAGUCGPCUUCCA
Unmodified sequence:	GGACGUUAAAUAGAUAAGCUAUGCCUAGUUACGGGCUGGGAAGAGAGUCGUCUUCCA
Secondary structure:	(((((.(..((((.....)))).(((((.......)))))......).)))))....
Homology model or structure extracted from PDB:	Model (last update Sept. 6, 2019)
Prepared by:	Database creators
Version:	1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Sept. 23, 2019
Folding free energy [kcal/mol]:	-6.70
Pre-aligned sequence: Pre-aligned secondary structure:	-GGACGUU""AUAGAU---AA---GCUAPGCCPAGPUACGKQCPGGGAA-------------------G-AG---------------AGUCGPCUUCCA .(((((.(..((((...........)))).(((((.......))))).........................................).)))))....
Publications:	Primary sequence of mitochondrial tRNA(Arg) of a nematode Ascaris suum: occurrence of unmodified adenosine at the first position of the anticodon. Y Watanabe, H Tsurui, T Ueda, R Furusihima-Shimogawara, S Takamiya, K Kita, K Nishikawa, K Watanabe Biochimica et biophysica acta volume: 1350 issue: 2 date: Feb. 7, 1997 PUBMED ID: 9048878

Your browser does not support the canvas element.