tdbR00000351

Name	Value
Coding AA:	Arg
Anticodon sequence:	NCG
Organism:	Haloferax volcanii NCBI:txid2246
RNA type:	cytoplasmic
Sequence:	GGGCGCUUAGCUCA(UCUGGACAGAGULCUUGGCUNCGKACCAAGUUGC?ACGGG]PBOAAUCCUGUAGCGCCCACCA
Unmodified sequence:	GGGCGCUUAGCUCAGUCUGGACAGAGUGCUUGGCUUCGGACCAAGUUGCCACGGGUUCAAAUCCUGUAGCGCCCACCA
Secondary structure:	(((((((..((((..........))))((((((.......))))))....(((((.......))))))))))))....
Homology model or structure extracted from PDB:	Model Download (last update Sept. 6, 2019)
Prepared by:	Database creators
Version:	1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Sept. 23, 2019
Folding free energy [kcal/mol]:	-26.80
Pre-aligned sequence: Pre-aligned secondary structure:	-GGGCGCUUAGCUCA(UCUGGAC-AGAGULCUUGGCUNCGKACCAAGUU-------------------GC?ACGGG]PBOAAUCCUGUAGCGCCCACCA .(((((((..((((...........))))((((((.......)))))).......................(((((.......))))))))))))....
Publications:	Halobacterium volcanii tRNAs. Identification of 41 tRNAs covering all amino acids, and the sequences of 33 class I tRNAs. R Gupta The Journal of biological chemistry volume: 259 issue: 15 date: Aug. 10, 1984 PUBMED ID: 6746655 *Structure of the archaeal transfer RNA nucleoside G-15 (2-amino-4,7-dihydro- 4-oxo-7-beta-D-ribofuranosyl-1H-pyrrolo[2,3-d]pyrimidine-5-carboximi dam ide (archaeosine)).** J M Gregson, P F Crain, C G Edmonds, R Gupta, T Hashizume, D W Phillipson, J A McCloskey The Journal of biological chemistry volume: 268 issue: 14 date: May 15, 1993 PUBMED ID: 7683667
Comments:	26 PARTIALLY G