tdbR00000211

Name	Value
Coding AA:	Leu
Anticodon sequence:	CAA
Organism:	Haloferax volcanii NCBI:txid2246
RNA type:	cytoplasmic
Sequence:	GCGAGGGUAGCUAA(UCAGGAAAAAGCRGCGGACUCAAKAPCCGCUCCCGUAGGGGUC?GUGGG]PBOAAUCCCUCCCCUCGCACCA
Unmodified sequence:	GCGAGGGUAGCUAAGUCAGGAAAAAGCGGCGGACUCAAGAUCCGCUCCCGUAGGGGUCCGUGGGUUCAAAUCCCUCCCCUCGCACCA
Secondary structure:	(((((((..(((............)))((((((.......)))))).............(.(((.......))).))))))))....
Homology model or structure extracted from PDB:	Model Download (by RNA Composer) (last update July 2, 2025)
Prepared by:	Database creators
Version:	1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: July 2, 2025
Folding free energy [kcal/mol]:	-25.80
Pre-aligned sequence: Pre-aligned secondary structure:	-GCGAGGGUAGCUAA(UCAGGAA-AAAGCRGCGGACUCAAKAPCCGCU-CCC----GUAG-----GGGUC?GUGGG]PBOAAUCCCUCCCCUCGCACCA .(((((((..(((.............)))((((((.......)))))).......................(.(((.......))).))))))))....
Publications:	*Structure of the archaeal transfer RNA nucleoside G-15 (2-amino-4,7-dihydro- 4-oxo-7-beta-D-ribofuranosyl-1H-pyrrolo[2,3-d]pyrimidine-5-carboximi dam ide (archaeosine)).** J M Gregson, P F Crain, C G Edmonds, R Gupta, T Hashizume, D W Phillipson, J A McCloskey The Journal of biological chemistry volume: 268 issue: 14 date: May 15, 1993 PUBMED ID: 7683667 Transfer RNAs of Halobacterium volcanii: Sequences of five leucine and three serine tRNAs R. Gupta FEBS letters volume: 7 issue: 1 date: Jan. 1, 1986 DOI: https://doi.org/10.1016/S0723-2020(86)80131-X

Model based on:

RNA Composer