We are using technical cookies that are necessary for page to work correctly.

tdbR00000381

NameValue
Coding AA: Ser
Anticodon sequence: GCU
Organism: Haloferax volcanii NCBI:txid2246
RNA type: cytoplasmic
Sequence: GUUGCGGUAGCCAA(CCUGGCCCAAGGCRCUGGGUUGCU6ACUCAGUGGCGUCAAGCCC??GGGG]PBGAAUCCCCGCCGCAACGCCA
Unmodified sequence: GUUGCGGUAGCCAAGCCUGGCCCAAGGCGCUGGGUUGCUAACUCAGUGGCGUCAAGCCCCCGGGGUUCGAAUCCCCGCCGCAACGCCA
Secondary structure: (((((((..(((.............)))((((((.......)))))).............(((((.......))))))))))))....
Homology model or
structure extracted from PDB:
Model Download (by RNA Composer) (last update July 2, 2025)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: July 2, 2025
Folding free energy [kcal/mol]: -28.50
Pre-aligned sequence:
Pre-aligned secondary structure:
-GUUGCGGUAGCCAA(CCUGGCCCAAGGCRCUGGGUUGCU6ACUCAGU-GGC----GUCAA----GCCC-??GGGG]PBGAAUCCCCGCCGCAACGCCA
.(((((((..(((.............)))((((((.......)))))).......................(((((.......))))))))))))....
Publications:
  • Structure of the archaeal transfer RNA nucleoside G*-15 (2-amino-4,7-dihydro- 4-oxo-7-beta-D-ribofuranosyl-1H-pyrrolo[2,3-d]pyrimidine-5-carboximi dam ide (archaeosine)).
    J M Gregson, P F Crain, C G Edmonds, R Gupta, T Hashizume, D W Phillipson, J A McCloskey
    The Journal of biological chemistry
    volume: 268 issue: 14 date: May 15, 1993 PUBMED ID: 7683667
  • Transfer RNAs of Halobacterium volcanii: Sequences of five leucine and three serine tRNAs
    R. Gupta
    FEBS letters
    volume: 7 issue: 1 date: Jan. 1, 1986 DOI: https://doi.org/10.1016/S0723-2020(86)80131-X

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
RNA Composer