tdbR00000248

Name	Value
Coding AA:	Leu
Anticodon sequence:	ÊAA
Organism:	Homo sapiens NCBI:txid9606
RNA type:	mitochondrial
Sequence:	GUUAAGAUKLCAGAGCCCGGDAAUCGCAPAAAACUÊAAAACUUUACAGU?AGAGGTPCA"UUCCUCUUCUUAACACCA
Unmodified sequence:	GUUAAGAUGGCAGAGCCCGGUAAUCGCAUAAAACU_AAAACUUUACAGUCAGAGGUUCAAUUCCUCUUCUUAACACCA
Secondary structure:	(((((((..((.(..........).)).((((.........)))).....(((((.......))))))))))))....
Homology model or structure extracted from PDB:	Model (last update Sept. 6, 2019)
Prepared by:	Database creators
Version:	1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Nov. 15, 2024
Folding free energy [kcal/mol]:	-5.80
Pre-aligned sequence: Pre-aligned secondary structure:	-GUUAAGAUKLCAGAGCCCGGDA-AUCGCAPAAAACU.AAAACUUUACA-------------------GU?AGAGGTPCA"UUCCUCUUCUUAACACCA .(((((((..((.(...........).)).((((.........))))........................(((((.......))))))))))))....
Publications:	Modification defect at anticodon wobble nucleotide of mitochondrial tRNAs(Leu)(UUR) with pathogenic mutations of mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes. T Yasukawa, T Suzuki, T Ueda, S Ohta, K Watanabe The Journal of biological chemistry volume: 275 issue: 6 date: Feb. 11, 2000 PUBMED ID: 10660592 MODOMICS: a database of RNA modification pathways. 2017 update. Pietro Boccaletto, Magdalena A Machnicka, Elzbieta Purta, Pawel Piatkowski, Blazej Baginski, Tomasz K Wirecki, Valérie de Crécy-Lagard, Robert Ross, Patrick A Limbach, Annika Kotter, Mark Helm, Janusz M Bujnicki Nucleic acids research volume: 46 issue: D1 date: Jan. 4, 2018 PUBMED ID: 29106616 DOI: 10.1093/nar/gkx1030

Secondary structure

Tertiary structure

Model based on: