We are using technical cookies that are necessary for page to work correctly.

tdbR00000248

NameValue
Coding AA: Leu
Anticodon sequence: ÊAA
Organism: Homo sapiens NCBI:txid9606
RNA type: mitochondrial
Sequence: GUUAAGAUKLCAGAGCCCGGDAAUCGCAPAAAACUÊAAAACUUUACAGU?AGAGGTPCA"UUCCUCUUCUUAACACCA
Unmodified sequence: GUUAAGAUGGCAGAGCCCGGUAAUCGCAUAAAACU_AAAACUUUACAGUCAGAGGUUCAAUUCCUCUUCUUAACACCA
Secondary structure: (((((((..((.(..........).)).((((.........)))).....(((((.......))))))))))))....
Homology model or
structure extracted from PDB:
Model (last update Sept. 6, 2019)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Nov. 15, 2024
Folding free energy [kcal/mol]: -5.80
Pre-aligned sequence:
Pre-aligned secondary structure:
-GUUAAGAUKLCAGAGCCCGGDA-AUCGCAPAAAACU.AAAACUUUACA-------------------GU?AGAGGTPCA"UUCCUCUUCUUAACACCA
.(((((((..((.(...........).)).((((.........))))........................(((((.......))))))))))))....
Publications:
  • Modification defect at anticodon wobble nucleotide of mitochondrial tRNAs(Leu)(UUR) with pathogenic mutations of mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes.
    T Yasukawa, T Suzuki, T Ueda, S Ohta, K Watanabe
    The Journal of biological chemistry
    volume: 275 issue: 6 date: Feb. 11, 2000 PUBMED ID: 10660592
  • MODOMICS: a database of RNA modification pathways. 2017 update.
    Pietro Boccaletto, Magdalena A Machnicka, Elzbieta Purta, Pawel Piatkowski, Blazej Baginski, Tomasz K Wirecki, Valérie de Crécy-Lagard, Robert Ross, Patrick A Limbach, Annika Kotter, Mark Helm, Janusz M Bujnicki
    Nucleic acids research
    volume: 46 issue: D1 date: Jan. 4, 2018 PUBMED ID: 29106616 DOI: 10.1093/nar/gkx1030

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on: