tdbR00000603

Name	Value
Coding AA:	Lys
Anticodon sequence:	tUU
Organism:	Homo sapiens NCBI:txid9606
RNA type:	cytoplasmic
Sequence:	CACUGUAA"LCUAACUUAGCAPPAACCUtUU6AGUUAAAGAUUAAGAGAACCA__CUCUUUACAGUGACCA
Unmodified sequence:	CACUGUAAAGCUAACUUAGCAUUAACCUUUUAAGUUAAAGAUUAAGAGAACCA__CUCUUUACAGUGACCA
Secondary structure:	(((((((..(((.....))).(((((.......))))).....(((((.......))))))))))))....
Homology model or structure extracted from PDB:	Model (last update Sept. 6, 2019)
Prepared by:	Database creators
Version:	1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Sept. 23, 2019
Folding free energy [kcal/mol]:	-12.70
Pre-aligned sequence: Pre-aligned secondary structure:	-CACUGUAA"LCU-AAC----U--U-AGCAPPAACCUtUU6AGUUAAAG-------------------AUUAAGAGAACCA__CUCUUUACAGUGACCA .(((((((..(((.............))).(((((.......)))))........................(((((.......))))))))))))....
Publications:	Defect in modification at the anticodon wobble nucleotide of mitochondrial tRNA(Lys) with the MERRF encephalomyopathy pathogenic mutation. T Yasukawa, T Suzuki, N Ishii, T Ueda, S Ohta, K Watanabe FEBS letters volume: 467 issue: 2-3 date: Feb. 11, 2000 PUBMED ID: 10675533 Taurine as a constituent of mitochondrial tRNAs: new insights into the functions of taurine and human mitochondrial diseases. Takeo Suzuki, Tsutomu Suzuki, Takeshi Wada, Kazuhiko Saigo, Kimitsuna Watanabe The EMBO journal volume: 21 issue: 23 date: Dec. 2, 2002 PUBMED ID: 12456664
Comments:	59 AC;60 AC