We are using technical cookies that are necessary for page to work correctly.

tdbR00000603

NameValue
Coding AA: Lys
Anticodon sequence: tUU
Organism: Homo sapiens NCBI:txid9606
RNA type: cytoplasmic
Sequence: CACUGUAA"LCUAACUUAGCAPPAACCUtUU6AGUUAAAGAUUAAGAGAACCA__CUCUUUACAGUGACCA
Unmodified sequence: CACUGUAAAGCUAACUUAGCAUUAACCUUUUAAGUUAAAGAUUAAGAGAACCA__CUCUUUACAGUGACCA
Secondary structure: (((((((..(((.....))).(((((.......))))).....(((((.......))))))))))))....
Homology model or
structure extracted from PDB:
Model (last update Sept. 6, 2019)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Nov. 15, 2024
Folding free energy [kcal/mol]: -12.70
Pre-aligned sequence:
Pre-aligned secondary structure:
-CACUGUAA"LCU-AAC----U--U-AGCAPPAACCUtUU6AGUUAAAG-------------------AUUAAGAGAACCA__CUCUUUACAGUGACCA
.(((((((..(((.............))).(((((.......)))))........................(((((.......))))))))))))....
Publications:
  • Defect in modification at the anticodon wobble nucleotide of mitochondrial tRNA(Lys) with the MERRF encephalomyopathy pathogenic mutation.
    T Yasukawa, T Suzuki, N Ishii, T Ueda, S Ohta, K Watanabe
    FEBS letters
    volume: 467 issue: 2-3 date: Feb. 11, 2000 PUBMED ID: 10675533
  • Taurine as a constituent of mitochondrial tRNAs: new insights into the functions of taurine and human mitochondrial diseases.
    Takeo Suzuki, Tsutomu Suzuki, Takeshi Wada, Kazuhiko Saigo, Kimitsuna Watanabe
    The EMBO journal
    volume: 21 issue: 23 date: Dec. 2, 2002 PUBMED ID: 12456664
Comments: 59 AC;60 AC

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on: