tdbR00000405 (deprecated)

Name	Value
Coding AA:	Ser
Anticodon sequence:	GCU
Organism:	Mesocricetus auratus NCBI:txid10036
RNA type:	mitochondrial
Sequence:	GAGAAUGUAUGCAAGAGCUGCU6ACUCCUGCUACCAUGUAUAAUAACAUGGCUUUCUUACCA
Unmodified sequence:	GAGAAUGUAUGCAAGAGCUGCUAACUCCUGCUACCAUGUAUAAUAACAUGGCUUUCUUACCA
Secondary structure:	(((((.(....((.(((.......))).))...(((((.......)))))).)))))....
Homology model or structure extracted from PDB:	Model (last update Sept. 6, 2019)
Prepared by:	Database creators
Version:	1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Sept. 22, 2019
Folding free energy [kcal/mol]:	100000.00
Pre-aligned sequence: Pre-aligned secondary structure:	-GAGAAUG-U----------------AUGCAAGAGCUGCU6ACUCCUGCUA--------------------CCAUGUAUAAU_CAUGGCUUUCUUACCA .(((((.(.....................((.(((.......))).)).......................(((((.......)))))).)))))....
Publications:	Sequence and structure of a serine transfer RNA with GCU anticodon from mosquito mitochondria. D T Dubin, C C HsuChen, G R Cleaves, K D Timko Journal of molecular biology volume: 176 issue: 2 date: June 25, 1984 PUBMED ID: 6565045
Next entry:	tdbR00000405 (Sept. 23, 2019, 3:15 p.m.)