tdbR00000601 (deprecated)

Name	Value
Coding AA:	Pyr
Anticodon sequence:	CUA
Organism:	Methanosarcina barkeri NCBI:txid2208
RNA type:	cytoplasmic
Sequence:	GGAAACC4GAUCAUGUAGAUCGAAUGGACUCUAAAUCCGUUCAGCCGGG]UAGAUUCCCGGGGUUUCCGCCA
Unmodified sequence:	GGAAACCUGAUCAUGUAGAUCGAAUGGACUCUAAAUCCGUUCAGCCGGGUUAGAUUCCCGGGGUUUCCGCCA
Secondary structure:	(((((((.((((.....))))..((((.......))))....(((((.......))))))))))))....
Homology model or structure extracted from PDB:	Model (last update Sept. 6, 2019)
Prepared by:	Database creators
Version:	1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Sept. 22, 2019
Folding free energy [kcal/mol]:	100000.00
Pre-aligned sequence: Pre-aligned secondary structure:	-GGAAACC4-GAUCA-U--G-U--AGAUCG_UGGACUCUAAAUCCG_CA---------------------GCCGGG]UAGAUUCCCGGGGUUUCCGCCA .(((((((..((((...........))))..((((.......)))).........................(((((.......))))))))))))....
Publications:	An aminoacyl-tRNA synthetase that specifically activates pyrrolysine. Carla Polycarpo, Alexandre Ambrogelly, Amélie Bérubé, SusAnn M Winbush, James A McCloskey, Pamela F Crain, John L Wood, Dieter Söll Proceedings of the National Academy of Sciences of the United States of America volume: 101 issue: 34 date: Aug. 24, 2004 epub: Aug. 16, 2004 PUBMED ID: 15314242
Next entry:	tdbR00000601 (Sept. 23, 2019, 3:15 p.m.)