tdbR00000178

NameValue
Coding AA: Lys
Anticodon sequence: $UU
Organism: Mycoplasma capricolum NCBI:txid2095
RNA type: cytoplasmic
Sequence: GACUCGUUAGCUCAGCCGGDAGAGCAACUGGCU$UU6ACCAGUGG7UCCGGGGUPCGAAUCCCCGACGAGUCACCA
Unmodified sequence: GACUCGUUAGCUCAGCCGGUAGAGCAACUGGCUUUUAACCAGUGGGUCCGGGGUUCGAAUCCCCGACGAGUCACCA
Secondary structure: (((((((..((((........)))).(((((.......))))).....(((((.......))))))))))))....
Homology model or
structure extracted from PDB:
Model Download (last update Sept. 6, 2019)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Sept. 23, 2019
Folding free energy [kcal/mol]: -30.10
Pre-aligned sequence:
Pre-aligned secondary structure:
-GACUCGUUAGCUCAGCC-GGD--AGAGCAACUGGCU!UU6ACCAGUGG-------------------7UCCGGGGUPCGAAUCCCCGACGAGUCACCA
.(((((((..((((...........)))).(((((.......)))))........................(((((.......))))))))))))....
Publications:
  • Codon recognition patterns as deduced from sequences of the complete set of transfer RNA species in Mycoplasma capricolum. Resemblance to mitochondria.
    Y Andachi, F Yamao, A Muto, S Osawa
    Journal of molecular biology
    volume: 209 issue: 1 date: Sept. 5, 1989 PUBMED ID: 2478713
  • MODOMICS: a database of RNA modification pathways. 2017 update.
    Pietro Boccaletto, Magdalena A Machnicka, Elzbieta Purta, Pawel Piatkowski, Blazej Baginski, Tomasz K Wirecki, Valérie de Crécy-Lagard, Robert Ross, Patrick A Limbach, Annika Kotter, Mark Helm, Janusz M Bujnicki
    Nucleic acids research
    volume: 46 issue: D1 date: Jan. 4, 2018 PUBMED ID: 29106616 DOI: 10.1093/nar/gkx1030
Your browser does not support the canvas element.