tdbR00000178

Name	Value
Coding AA:	Lys
Anticodon sequence:	$UU
Organism:	Mycoplasma capricolum NCBI:txid2095
RNA type:	cytoplasmic
Sequence:	GACUCGUUAGCUCAGCCGGDAGAGCAACUGGCU$UU6ACCAGUGG7UCCGGGGUPCGAAUCCCCGACGAGUCACCA
Unmodified sequence:	GACUCGUUAGCUCAGCCGGUAGAGCAACUGGCUUUUAACCAGUGGGUCCGGGGUUCGAAUCCCCGACGAGUCACCA
Secondary structure:	(((((((..((((........)))).(((((.......))))).....(((((.......))))))))))))....
Homology model or structure extracted from PDB:	Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025)
Prepared by:	Database creators
Version:	1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: July 2, 2025
Folding free energy [kcal/mol]:	-30.10
Pre-aligned sequence: Pre-aligned secondary structure:	-GACUCGUUAGCUCAGCC-GGD--AGAGCAACUGGCU!UU6ACCAGUGG-------------------7UCCGGGGUPCGAAUCCCCGACGAGUCACCA .(((((((..((((...........)))).(((((.......)))))........................(((((.......))))))))))))....
Publications:	MODOMICS: a database of RNA modification pathways. 2017 update. Pietro Boccaletto, Magdalena A Machnicka, Elzbieta Purta, Pawel Piatkowski, Blazej Baginski, Tomasz K Wirecki, Valérie de Crécy-Lagard, Robert Ross, Patrick A Limbach, Annika Kotter, Mark Helm, Janusz M Bujnicki Nucleic acids research volume: 46 issue: D1 date: Jan. 4, 2018 PUBMED ID: 29106616 DOI: 10.1093/nar/gkx1030 Codon recognition patterns as deduced from sequences of the complete set of transfer RNA species in Mycoplasma capricolum. Resemblance to mitochondria. Y Andachi, F Yamao, A Muto, S Osawa Journal of molecular biology volume: 209 issue: 1 date: Sept. 5, 1989 PUBMED ID: 2478713

Secondary structure

Tertiary structure

Model based on:

Moderna

RNA Composer

We are using technical cookies that are necessary for page to work correctly.