tdbR00000459

Name	Value
Coding AA:	Val
Anticodon sequence:	UAC
Organism:	Neurospora crassa NCBI:txid5141
RNA type:	mitochondrial
Sequence:	GAGAGAUUAGCUCAGUUGGDAGAGCAACCGUUUUACACACGGAAGGUUGGGUGTPCGAAUCACCCAUUUCUCACCA
Unmodified sequence:	GAGAGAUUAGCUCAGUUGGUAGAGCAACCGUUUUACACACGGAAGGUUGGGUGUUCGAAUCACCCAUUUCUCACCA
Secondary structure:	(((((((..((((........))))..((((.......))))......(((((.......))))))))))))....
Homology model or structure extracted from PDB:	Model Download (last update Sept. 6, 2019)
Prepared by:	Database creators
Version:	1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Sept. 23, 2019
Folding free energy [kcal/mol]:	-22.50
Pre-aligned sequence: Pre-aligned secondary structure:	-GAGAGAUUAGCUCAGUU-GGD--AGAGCAACCGUUUUACACACGGAAG-------------------GUUGGGUGTPCGAAUCACCCAUUUCUCACCA .(((((((..((((...........))))..((((.......)))).........................(((((.......))))))))))))....
Publications:	Novel features in the genetic code and codon reading patterns in Neurospora crassa mitochondria based on sequences of six mitochondrial tRNAs. J E Heckman, J Sarnoff, B Alzner-DeWeerd, S Yin, U L RajBhandary Proceedings of the National Academy of Sciences of the United States of America volume: 77 issue: 6 PUBMED ID: 6447871
Comments:	37 + OR *

Your browser does not support the canvas element.