tdbR00000179

Name	Value
Coding AA:	Lys
Anticodon sequence:	$UU
Organism:	Bacillus subtilis NCBI:txid1423
RNA type:	cytoplasmic
Sequence:	GAGCCAUUAGCUCAGUDGGDAGAGCAUCUGACU$UUÿAPCAGAGG7UCGAAGGTPCGAGUCCUUCAUGGCUCACCA
Unmodified sequence:	GAGCCAUUAGCUCAGUUGGUAGAGCAUCUGACUUUUAAUCAGAGGGUCGAAGGUUCGAGUCCUUCAUGGCUCACCA
Secondary structure:	(((((((..((((........)))).(((((.......))))).....(((((.......))))))))))))....
Homology model or structure extracted from PDB:	Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025)
Prepared by:	Database creators
Version:	1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: July 2, 2025
Folding free energy [kcal/mol]:	-25.10
Pre-aligned sequence: Pre-aligned secondary structure:	-GAGCCAUUAGCUCAGUD-GGD--AGAGCAUCUGACU$UUHAPCAGAGG-------------------7UCGAAGGTPCGAGUCCUUCAUGGCUCACCA .(((((((..((((...........)))).(((((.......)))))........................(((((.......))))))))))))....
Publications:	Lysine tRNAs from Bacillus subtilis 168: structural analysis. B S Vold, D E Keith, M Buck, J A McCloskey, H Pang Nucleic acids research volume: 10 issue: 10 date: May 25, 1982 PUBMED ID: 6808464 Identification of 2-methylthio cyclic N6-threonylcarbamoyladenosine (ms2ct6A) as a novel RNA modification at position 37 of tRNAs. Byeong-Il Kang, Kenjyo Miyauchi, Michal Matuszewski, Gabriel Silveira D'Almeida, Mary Anne T Rubio, Juan D Alfonzo, Kazuki Inoue, Yuriko Sakaguchi, Takeo Suzuki, Elzbieta Sochacka, Tsutomu Suzuki Nucleic acids research volume: 45 issue: 4 date: Feb. 28, 2017 PUBMED ID: 27913733 DOI: 10.1093/nar/gkw1120
Comments:	37 CAN BE 6 OR [

Secondary structure

Tertiary structure

Model based on:

Moderna

RNA Composer

We are using technical cookies that are necessary for page to work correctly.