tdbR00000370
| Name | Value |
|---|---|
| Coding AA: | Arg |
| Anticodon sequence: | 1CU |
| Organism: | Saccharomyces cerevisiae NCBI:txid4932 |
| RNA type: | cytoplasmic |
| Sequence: | GCUCGCGUKLCGUAADGGCAACGCRPCUGACU1CU6APCAGAAGADUAUGGGTPCG"CCCCCAUCGUGAGUGCCA |
| Unmodified sequence: | GCUCGCGUGGCGUAAUGGCAACGCGUCUGACUUCUAAUCAGAAGAUUAUGGGUUCGACCCCCAUCGUGAGUGCCA |
| Secondary structure: | (((((((..((((.......)))).(((((.......))))).....(((((.......)))))))))))).... |
| Homology model or structure extracted from PDB: |
Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025) |
| Prepared by: | Database creators |
| Version: | 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: June 29, 2026 |
| Folding free energy [kcal/mol]: | -20.80 |
| Pre-aligned sequence: Pre-aligned secondary structure: |
-GCUCGCGUKLCGUAAD--GGC--AACGCRPCUGACU1CU6APCAGAAG-------------------ADUAUGGGTPCG"CCCCCAUCGUGAGUGCCA .(((((((..((((...........)))).(((((.......)))))........................(((((.......)))))))))))).... |
| Publications: |
|
Aminoacylation
| Name | Value |
|---|---|
| Positive identity elements regulating aminoacylation: | C35 plus G36/U36 combinations; U20/C20a/U20a context; A38 in some isoacceptors |
| Negative identity elements antideterminants of aminoacylation: | Asp identity can be cryptic in yeast tRNAArg; mutations C38 and G73 switch minor tRNA4Arg(CCG) toward Asp acceptance. |
| Citation: | Liu,W., Huang,Y., Eriani,G., Gangloff,J., Wang,E.-D. and Wang,Y.-L. (1999) A single base substitution in the variable pocket of yeast tRNAArg eliminates species-specific aminoacylation. Biochim. Biophys. Acta, 1473, 356–362. |
| DOI: | 10.1016/s0304-4165(99)00143-9 |
| PMID: | 10594373 |
Secondary structure
Tertiary structure
Model based on:
