tdbR00000035

Name	Value
Coding AA:	Asp
Anticodon sequence:	GUC
Organism:	Saccharomyces cerevisiae NCBI:txid4932
RNA type:	cytoplasmic
Sequence:	UCCGUGAUAGUUPAADGGDCAGAAUGGGCGCPUGUCKCGUGCCAGAU?GGGGTPCAAUUCCCCGUCGCGGAGCCA
Unmodified sequence:	UCCGUGAUAGUUUAAUGGUCAGAAUGGGCGCUUGUCGCGUGCCAGAUCGGGGUUCAAUUCCCCGUCGCGGAGCCA
Secondary structure:	(((((((..((((........)))).(((((.......)))))....(((((.......))))))))))))....
PDB ID:	2tra, 1il2
Homology model or structure extracted from PDB:	Extracted Download (last update Sept. 6, 2019)
Prepared by:	Database creators
Version:	1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Sept. 23, 2019
Folding free energy [kcal/mol]:	-23.70
Pre-aligned sequence: Pre-aligned secondary structure:	-UCCGUGAUAGUUPAAD--GGDC-AGAAUGGGCGCPUGUCKCGUGCCAG-------------------A-U?GGGGTPCAAUUCCCCGUCGCGGAGCCA .(((((((..((((...........)))).(((((.......)))))........................(((((.......))))))))))))....
Publications:	The primary structure of aspartate transfer ribonucleic acid from brewer's yeast. II. Partial digestions with pancreatic ribonuclease and T 1 ribonuclease and derivation of complete sequence. J Gangloff, G Keith, J P Ebel, G Dirheimer Biochimica et biophysica acta volume: 259 issue: 2 date: Jan. 31, 1972 PUBMED ID: 4551153 Restrained refinement of two crystalline forms of yeast aspartic acid and phenylalanine transfer RNA crystals. E Westhof, P Dumas, D Moras Acta crystallographica. Section A, Foundations of crystallography volume: 44 ( Pt 2) date: March 1, 1988 PUBMED ID: 3272146 The structure of an AspRS-tRNA(Asp) complex reveals a tRNA-dependent control mechanism. L Moulinier, S Eiler, G Eriani, J Gangloff, J C Thierry, K Gabriel, W H McClain, D Moras The EMBO journal volume: 20 issue: 18 date: Sept. 17, 2001 PUBMED ID: 11566892