tdbR00000021

Name	Value
Coding AA:	Cys
Anticodon sequence:	GCA
Organism:	Saccharomyces cerevisiae NCBI:txid4932
RNA type:	cytoplasmic
Sequence:	GCUCGUAUGGCGCAGDGGDAGCGCAGCAGAPUGCA+APCUGUUG7D?CUUAGTPCG"UCCUGAGUGCGAGCUCCA
Unmodified sequence:	GCUCGUAUGGCGCAGUGGUAGCGCAGCAGAUUGCAAAUCUGUUGGUCCUUAGUUCGAUCCUGAGUGCGAGCUCCA
Secondary structure:	(((((((..((((.......))))((((((.......))))))....(((((.......))))))))))))....
PDB ID:	3eph, 3epj, 3epk, 3epl
Homology model or structure extracted from PDB:	Extracted Download (last update Sept. 6, 2019)
Prepared by:	Database creators
Version:	1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: July 1, 2025
Folding free energy [kcal/mol]:	-22.10
Pre-aligned sequence: Pre-aligned secondary structure:	-GCUCGUAUGGCGCAGD--GGD--AGCGCAGCAGAPUGCA+APCUGUUG-------------------7D?CUUAGTPCG"UCCUGAGUGCGAGCUCCA .(((((((..((((...........))))((((((.......)))))).......................(((((.......))))))))))))....
Publications:	The nucleotide sequence of cysteine transfer ribonucleic acid from baker's yeast. Identification of the products from partial degradation of the molecule and derivation of the complete sequence. N J Holness, G Atfield The Biochemical journal volume: 153 issue: 2 date: Feb. 1, 1976 PUBMED ID: 819006 Crystallographic snapshots of eukaryotic dimethylallyltransferase acting on tRNA: insight into tRNA recognition and reaction mechanism. Chun Zhou, Raven H Huang Proceedings of the National Academy of Sciences of the United States of America volume: 105 issue: 42 date: Oct. 21, 2008 epub: Oct. 13, 2008 PUBMED ID: 18852462 DOI: 10.1073/pnas.0805680105

Secondary structure

Tertiary structure

Model based on:

Moderna

RNA Composer

We are using technical cookies that are necessary for page to work correctly.