We are using technical cookies that are necessary for page to work correctly.

tdbR00000021

NameValue
Coding AA: Cys
Anticodon sequence: GCA
Organism: Saccharomyces cerevisiae NCBI:txid4932
RNA type: cytoplasmic
Sequence: GCUCGUAUGGCGCAGDGGDAGCGCAGCAGAPUGCA+APCUGUUG7D?CUUAGTPCG"UCCUGAGUGCGAGCUCCA
Unmodified sequence: GCUCGUAUGGCGCAGUGGUAGCGCAGCAGAUUGCAAAUCUGUUGGUCCUUAGUUCGAUCCUGAGUGCGAGCUCCA
Secondary structure: (((((((..((((.......))))((((((.......))))))....(((((.......))))))))))))....
PDB ID: 3eph, 3epj, 3epk, 3epl
Homology model or
structure extracted from PDB:
Extracted Download (last update Sept. 6, 2019)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: July 1, 2025
Folding free energy [kcal/mol]: -22.10
Pre-aligned sequence:
Pre-aligned secondary structure:
-GCUCGUAUGGCGCAGD--GGD--AGCGCAGCAGAPUGCA+APCUGUUG-------------------7D?CUUAGTPCG"UCCUGAGUGCGAGCUCCA
.(((((((..((((...........))))((((((.......)))))).......................(((((.......))))))))))))....
Publications:
  • The nucleotide sequence of cysteine transfer ribonucleic acid from baker's yeast. Identification of the products from partial degradation of the molecule and derivation of the complete sequence.
    N J Holness, G Atfield
    The Biochemical journal
    volume: 153 issue: 2 date: Feb. 1, 1976 PUBMED ID: 819006
  • Crystallographic snapshots of eukaryotic dimethylallyltransferase acting on tRNA: insight into tRNA recognition and reaction mechanism.
    Chun Zhou, Raven H Huang
    Proceedings of the National Academy of Sciences of the United States of America
    volume: 105 issue: 42 date: Oct. 21, 2008 epub: Oct. 13, 2008 PUBMED ID: 18852462 DOI: 10.1073/pnas.0805680105

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
Moderna
RNA Composer