tdbR00000237

Name	Value
Coding AA:	Leu
Anticodon sequence:	!AA
Organism:	Saccharomyces cerevisiae NCBI:txid4932
RNA type:	mitochondrial
Sequence:	GCUAUUUUGGUGGAADUGGDAGACACRAUACPCU!AAKAPGUAUUACUUUACAGUAUGAAGGTPCAAGUCCUUUAAAUAGCACCA
Unmodified sequence:	GCUAUUUUGGUGGAAUUGGUAGACACGAUACUCUUAAGAUGUAUUACUUUACAGUAUGAAGGUUCAAGUCCUUUAAAUAGCACCA
Secondary structure:	(((((((..(((...........)))(((((.........)))))............(((((.......))))))))))))....
Homology model or structure extracted from PDB:	Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025)
Prepared by:	Database creators
Version:	1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: July 2, 2025
Folding free energy [kcal/mol]:	-12.90
Pre-aligned sequence: Pre-aligned secondary structure:	-GCUAUUUUGGUGGAADU-GGDA-GACACRAUACPCU!AAKAPGUAUU-ACU----UUAC-----AGUA-UGAAGGTPCAAGUCCUUUAAAUAGCACCA .(((((((..(((.............)))(((((.........))))).......................(((((.......))))))))))))....
Publications:	Codon reading patterns in Saccharomyces cerevisiae mitochondria based on sequences of mitochondrial tRNAs. A P Sibler, G Dirheimer, R P Martin FEBS letters volume: 194 issue: 1 date: Jan. 1, 1986 PUBMED ID: 2416594 5-[[(carboxymethyl)amino]methyl]uridine is found in the anticodon of yeast mitochondrial tRNAs recognizing two-codon families ending in a purine. R P Martin, A P Sibler, C W Gehrke, K Kuo, C G Edmonds, J A McCloskey, G Dirheimer Biochemistry volume: 29 issue: 4 date: Jan. 30, 1990 PUBMED ID: 2187534

Model based on:

Moderna

RNA Composer