tdbR00000284

Name	Value
Coding AA:	Met
Anticodon sequence:	CAU
Organism:	Saccharomyces cerevisiae NCBI:txid4932
RNA type:	cytoplasmic
Sequence:	GCUUCAGUALCUCAGDAGGAAGAGCRPCAGPCUCAU6APCUGAAG7D?GAGAGTPCG"ACCUCUCCUGGAGCACCA
Unmodified sequence:	GCUUCAGUAGCUCAGUAGGAAGAGCGUCAGUCUCAUAAUCUGAAGGUCGAGAGUUCGAACCUCUCCUGGAGCACCA
Secondary structure:	(((((((..((((........)))).((((.........)))).....(((((.......))))))))))))....
Homology model or structure extracted from PDB:	Model Download (last update Sept. 6, 2019)
Prepared by:	Database creators
Version:	1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Sept. 23, 2019
Folding free energy [kcal/mol]:	-22.00
Pre-aligned sequence: Pre-aligned secondary structure:	-GCUUCAGUALCUCAGDA-GGA--AGAGCRPCAGPCUCAU6APCUGAAG-------------------7D?GAGAGTPCG"ACCUCUCCUGGAGCACCA .(((((((..((((...........)))).((((.........))))........................(((((.......))))))))))))....
Publications:	The primary structure of a non-initiating methionine-specific tRNA from brewer's yeast. H Gruhl, H Feldmann European journal of biochemistry volume: 68 issue: 1 PUBMED ID: 786636 The primary structure of non-initiator methionine transfer ribonucleic acid from Bakers' yeast. II. Partial digestion with ribonuclease T1 and derivation of the complete sequence. O Koiwai, M Miyazaki Journal of biochemistry volume: 80 issue: 5 PUBMED ID: 826525
Comments:	47 PARTIALLY U