We are using technical cookies that are necessary for page to work correctly.

tdbR00000083

NameValue
Coding AA: Phe
Anticodon sequence: #AA
Organism: Saccharomyces cerevisiae NCBI:txid4932
RNA type: cytoplasmic
Sequence: GCGGAUUUALCUCAGDDGGGAGAGCRCCAGABU#AAYAP?UGGAG7UC?UGUGTPCG"UCCACAGAAUUCGCACCA
Unmodified sequence: GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA
Secondary structure: (((((((..((((........)))).(((((.......))))).....(((((.......))))))))))))....
PDB ID: 1ehz, 1evv, 4tna, 5axm, 5axn
Homology model or
structure extracted from PDB:
Extracted Download (last update Sept. 6, 2019)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: July 1, 2025
Folding free energy [kcal/mol]: -22.40
Pre-aligned sequence:
Pre-aligned secondary structure:
-GCGGAUUUALCUCAGDD-GGG--AGAGCRCCAGABU#AAYAP?UGGAG-------------------7UC?UGUGTPCG"UCCACAGAAUUCGCACCA
.(((((((..((((...........)))).(((((.......)))))........................(((((.......))))))))))))....
Publications:
  • Specific photoreactions between psoralens and yeast-tRNAPhe.
    P E Nielsen, V Leick
    Biochemical and biophysical research communications
    volume: 106 issue: 1 date: May 14, 1982 PUBMED ID: 6808999
  • The crystal structure of yeast phenylalanine tRNA at 1.93 A resolution: a classic structure revisited.
    H Shi, P B Moore
    RNA (New York, N.Y.)
    volume: 6 issue: 8 PUBMED ID: 10943889
  • The crystal structure of yeast phenylalanine tRNA at 2.0 A resolution: cleavage by Mg(2+) in 15-year old crystals.
    L Jovine, S Djordjevic, D Rhodes
    Journal of molecular biology
    volume: 301 issue: 2 date: Aug. 11, 2000 PUBMED ID: 10926517
  • Further refinement of the structure of yeast tRNAPhe.
    B Hingerty, R S Brown, A Jack
    Journal of molecular biology
    volume: 124 issue: 3 date: Sept. 25, 1978 PUBMED ID: 361973
  • Template-dependent nucleotide addition in the reverse (3'-5') direction by Thg1-like protein.
    Shoko Kimura, Tateki Suzuki, Meirong Chen, Koji Kato, Jian Yu, Akiyoshi Nakamura, Isao Tanaka, Min Yao
    Science advances
    volume: 2 issue: 3 epub: March 25, 2016 PUBMED ID: 27051866 DOI: e1501397

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
Moderna
RNA Composer