tdbR00000324

Name	Value
Coding AA:	Pro
Anticodon sequence:	NGG
Organism:	Saccharomyces cerevisiae NCBI:txid4932
RNA type:	cytoplasmic
Sequence:	GGGBGUGUGGUCPAGDGGDAUGAUUCUCGCPUNGGKPGCGAGAG7CCCUGGGTPCA"UUCCCAGCUCGCCCCCCA
Unmodified sequence:	GGGCGUGUGGUCUAGUGGUAUGAUUCUCGCUUUGGGUGCGAGAGGCCCUGGGUUCAAUUCCCAGCUCGCCCCCCA
Secondary structure:	(((((.(..(((.........)))((((((.......))))))....(((((.......)))))).)))))....
Homology model or structure extracted from PDB:	Model Download (last update Sept. 6, 2019)
Prepared by:	Database creators
Version:	1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Sept. 23, 2019
Folding free energy [kcal/mol]:	-24.80
Pre-aligned sequence: Pre-aligned secondary structure:	-GGGBGUGUGGUCPAGD--GGD--AUGAUUCUCGCPUNGGKPGCGAGAG-------------------7CCCUGGGTPCA"UUCCCAGCUCGCCCCCCA .(((((.(..(((.............)))((((((.......)))))).......................(((((.......)))))).)))))....
Publications:	Splicing of a yeast proline tRNA containing a novel suppressor mutation in the anticodon stem. M Winey, M D Mendenhall, C M Cummins, M R Culbertson, G Knapp Journal of molecular biology volume: 192 issue: 1 date: Nov. 5, 1986 PUBMED ID: 3546704
Comments:	27 IS C OR ?; 29 IS C OR ?; 48 IS C OR ?; 49 IS C OR ?