tdbR00000406
| Name | Value |
|---|---|
| Coding AA: | Ser |
| Anticodon sequence: | &GA |
| Organism: | Saccharomyces cerevisiae NCBI:txid4932 |
| RNA type: | cytoplasmic |
| Sequence: | GGCACUAUGGCMGAGD#GDDAAGGCRACAGA'U&GA+APCUGUJGGGCUCUGCCCG?GCUGGTPCAAAUCCUGCUGGUGUCGCCA |
| Unmodified sequence: | GGCACUAUGGCCGAGUGGUUAAGGCGACAGACUUGAAAUCUGUUGGGCUCUGCCCGCGCUGGUUCAAAUCCUGCUGGUGUCGCCA |
| Secondary structure: | (((((((..(((..........)))((((((.......)))))).............((.((.......)).))))))))).... |
| Homology model or structure extracted from PDB: |
Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025) |
| Prepared by: | Database creators |
| Version: | 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Aug. 26, 2026 |
| Folding free energy [kcal/mol]: | -19.60 |
| Pre-aligned sequence: Pre-aligned secondary structure: |
-GGCACUAUGGCMGAGD--#GDD-AAGGCRACAGA<UNGA+APCUGUJ-GGGC---UCU-----GCCCG-?GCUGGTPCAAAUCCUGCUGGUGUCGCCA .(((((((..(((.............)))((((((.......)))))).......................((.((.......)).))))))))).... |
| Publications: |
|
| Comments: | 32 < IS PROBABLY ' |
Aminoacylation
| Name | Value |
|---|---|
| Positive identity elements regulating aminoacylation: | G73; large variable arm; A27-U43 context in some eukaryal tRNAsSer |
| Negative identity elements antideterminants of aminoacylation: | Anticodon is not a major determinant; Pro-anticodon tRNASer variants can remain serylated and cause mistranslation. |
| Citation: | Zimmerman,S.M., Kon,Y., Hauke,A.C., Ruiz,B.Y., Fields,S. and Phizicky,E.M. (2018) Conditional accumulation of toxic tRNAs to cause amino acid misincorporation. Nucleic Acids Res., 46, 7831–7843. |
| DOI: | 10.1093/nar/gky812 |
| PMID: | 30239700 |
Secondary structure
Tertiary structure
Model based on:
