We are using technical cookies that are necessary for page to work correctly.

tdbR00000406

NameValue
Coding AA: Ser
Anticodon sequence: &GA
Organism: Saccharomyces cerevisiae NCBI:txid4932
RNA type: cytoplasmic
Sequence: GGCACUAUGGCMGAGD#GDDAAGGCRACAGA'U&GA+APCUGUJGGGCUCUGCCCG?GCUGGTPCAAAUCCUGCUGGUGUCGCCA
Unmodified sequence: GGCACUAUGGCCGAGUGGUUAAGGCGACAGACUUGAAAUCUGUUGGGCUCUGCCCGCGCUGGUUCAAAUCCUGCUGGUGUCGCCA
Secondary structure: (((((((..(((..........)))((((((.......)))))).............((.((.......)).)))))))))....
Homology model or
structure extracted from PDB:
Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Aug. 26, 2026
Folding free energy [kcal/mol]: -19.60
Pre-aligned sequence:
Pre-aligned secondary structure:
-GGCACUAUGGCMGAGD--#GDD-AAGGCRACAGA<UNGA+APCUGUJ-GGGC---UCU-----GCCCG-?GCUGGTPCAAAUCCUGCUGGUGUCGCCA
.(((((((..(((.............)))((((((.......)))))).......................((.((.......)).)))))))))....
Publications:
  • Only one of two closely related yeast suppressor tRNA genes contains an intervening sequence.
    M V Olson, G S Page, A Sentenac, P W Piper, M Worthington, R B Weiss, B D Hall
    Nature
    volume: 291 issue: 5815 date: June 11, 1981 PUBMED ID: 6262655
  • Actin-binding protein ABP140 is a methyltransferase for 3-methylcytidine at position 32 of tRNAs in Saccharomyces cerevisiae.
    Akiko Noma, Sanghyun Yi, Takayuki Katoh, Yoshimi Takai, Takeo Suzuki, Tsutomu Suzuki
    RNA (New York, N.Y.)
    volume: 17 issue: 6 epub: April 25, 2011 PUBMED ID: 21518805 DOI: 10.1261/rna.2653411
Comments: 32 < IS PROBABLY '

Aminoacylation

NameValue
Positive identity elements regulating aminoacylation: G73; large variable arm; A27-U43 context in some eukaryal tRNAsSer
Negative identity elements antideterminants of aminoacylation: Anticodon is not a major determinant; Pro-anticodon tRNASer variants can remain serylated and cause mistranslation.
Citation: Zimmerman,S.M., Kon,Y., Hauke,A.C., Ruiz,B.Y., Fields,S. and Phizicky,E.M. (2018) Conditional accumulation of toxic tRNAs to cause amino acid misincorporation. Nucleic Acids Res., 46, 7831–7843.
DOI: 10.1093/nar/gky812
PMID: 30239700

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
Moderna
RNA Composer