tdbR00000490

Name	Value
Coding AA:	Trp
Anticodon sequence:	!CA
Organism:	Saccharomyces cerevisiae NCBI:txid4932
RNA type:	mitochondrial
Sequence:	AAGGAUAUAGUUUAADGGDAAAACAGUUGAPU!CAHAPCAAUCAUUAGGAGTPCGAAUCUCUUUAUCCUUGCCA
Unmodified sequence:	AAGGAUAUAGUUUAAUGGUAAAACAGUUGAUUUCAAAUCAAUCAUUAGGAGUUCGAAUCUCUUUAUCCUUGCCA
Secondary structure:	(((((((..((((.......)))).(((((.......)))))....(((((.......))))))))))))....
Homology model or structure extracted from PDB:	Model Download (last update Sept. 6, 2019)
Prepared by:	Database creators
Version:	1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Sept. 23, 2019
Folding free energy [kcal/mol]:	-9.80
Pre-aligned sequence: Pre-aligned secondary structure:	-AAGGAUAUAGUUUAAD--GGD--AAAACAGUUGAPU!CAHAPCAAUCA-------------------U-UAGGAGTPCGAAUCUCUUUAUCCUUGCCA .(((((((..((((...........)))).(((((.......)))))........................(((((.......))))))))))))....
Publications:	[Primary structure of yeast mitochondrial tryptophan-tRNA capable of translating the termination U-G-A codon]. A P Sibler, R Bordonné, G Dirheimer, R Martin Comptes rendus des seances de l'Academie des sciences. Serie D, Sciences naturelles volume: 290 issue: 11 date: March 17, 1980 PUBMED ID: 6769601 5-[[(carboxymethyl)amino]methyl]uridine is found in the anticodon of yeast mitochondrial tRNAs recognizing two-codon families ending in a purine. R P Martin, A P Sibler, C W Gehrke, K Kuo, C G Edmonds, J A McCloskey, G Dirheimer Biochemistry volume: 29 issue: 4 date: Jan. 30, 1990 PUBMED ID: 2187534
Comments:	37 + OR *