tdbR00000069

NameValue
Coding AA: Phe
Anticodon sequence: GAA
Organism: Synechococcus sp. PCC 7002 NCBI:txid32049
RNA type: cytoplasmic
Sequence: GCCAGGAUAGCNCAGUD#GDAGAGCAGAGGACUGAA*APCCUCGU7UCGGCGGTPCAAUUCCGCCUCCCGGCACCA
Unmodified sequence: GCCAGGAUAGCUCAGUUGGUAGAGCAGAGGACUGAAAAUCCUCGUGUCGGCGGUUCAAUUCCGCCUCCCGGCACCA
Secondary structure: (((.(((..((((........)))).(((((.......))))).....(((((.......)))))))).)))....
Homology model or
structure extracted from PDB:
Model Download (last update Sept. 6, 2019)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Sept. 23, 2019
Folding free energy [kcal/mol]: -28.70
Pre-aligned sequence:
Pre-aligned secondary structure:
-GCCAGGAUAGCNCAGUD-#GD--AGAGCAGAGGACUGAA*APCCUCGU-------------------7UCGGCGGTPCAAUUCCGCCUCCCGGCACCA
.(((.(((..((((...........)))).(((((.......)))))........................(((((.......)))))))).)))....
Publications:
  • The nucleotide sequence of blue-green algae phenylalanine-tRNA and the evolutionary origin of chloroplasts.
    L I Hecker, W E Barnett, F K Lin, T D Furr, J E Heckman, U L RajBhandary, S H Chang
    Nucleic acids research
    volume: 10 issue: 20 date: Oct. 25, 1982 PUBMED ID: 6817301
  • The nucleotide sequence of blue-green algae phenylalanine-tRNA and the evolutionary origin of chloroplasts.
    L I Hecker, W E Barnett, F K Lin, T D Furr, J E Heckman, U L RajBhandary, S H Chang
    Nucleic acids research
    volume: 10 issue: 20 date: Oct. 25, 1982 PUBMED ID: 6817301
Your browser does not support the canvas element.