tdbR00000635

Name	Value
Coding AA:	Ala
Anticodon sequence:	UG<
Organism:	Homo sapiens NCBI:txid9606
RNA type:	cytoplasmic
Sequence:	GGGGAUGUAGCUCAGUGGUAGAGCGCAUGCUUUG<ACGUAUGA;GCCCCGGGUUCAAUCCCCGGCAUCUCCACCA
Unmodified sequence:	GGGGAUGUAGCUCAGUGGUAGAGCGCAUGCUUUGCACGUAUGAGGCCCCGGGUUCAAUCCCCGGCAUCUCCACCA
Secondary structure:	(((((((..((((.......)))).(((((.......))))).....(((((.......))))))))))))....
Homology model or structure extracted from PDB:	Model Download (last update Sept. 6, 2019)
Prepared by:	Database creators
Version:	1 (Sept. 6, 2019), created: May 30, 2019, modified: Sept. 23, 2019
Folding free energy [kcal/mol]:	-25.80
Pre-aligned sequence: Pre-aligned secondary structure:	-GGGGAUGUAGCUCAGU--GGU--AGAGCGCAUGCUUUG<ACGUAUGA;-------------------GCCCCGGGUUCAAUCCCCGGCAUCUCCACCA .(((((((..((((...........)))).(((((.......)))))........................(((((.......))))))))))))....
Publications:	Characterizing Expression and Processing of Precursor and Mature Human tRNAs by Hydro-tRNAseq and PAR-CLIP. Tasos Gogakos, Miguel Brown, Aitor Garzia, Cindy Meyer, Markus Hafner, Thomas Tuschl Cell reports volume: 20 issue: 6 date: Aug. 8, 2017 PUBMED ID: 28793268 DOI: S2211-1247(17)30995-6
Comments:	Sequence obtained from hydro-tRNAseq; modified nucleosides were not determined by MS, only predicted by mismatches frequency; relative abundance among tRNAAla in HEK293 cells:16.7%