tdbR00000638
| Name | Value |
|---|---|
| Coding AA: | Ala |
| Anticodon sequence: | CGC |
| Organism: | Homo sapiens NCBI:txid9606 |
| RNA type: | cytoplasmic |
| Sequence: | GGGGAUGUAGCUCAGUGGUAGAGCGCAUGCUUCGCAUGUAUGAGGCCCCGGGUUCGAUCCCCGGCAUCUCCACCA |
| Unmodified sequence: | GGGGAUGUAGCUCAGUGGUAGAGCGCAUGCUUCGCAUGUAUGAGGCCCCGGGUUCGAUCCCCGGCAUCUCCACCA |
| Secondary structure: | (((((((..((((.......)))).(((((.......))))).....(((((.......)))))))))))).... |
| Homology model or structure extracted from PDB: |
Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025) |
| Prepared by: | Database creators |
| Version: | 1 (Sept. 6, 2019), created: May 30, 2019, modified: June 29, 2026 |
| Folding free energy [kcal/mol]: | -26.50 |
| Pre-aligned sequence: Pre-aligned secondary structure: |
-GGGGAUGUAGCUCAGU--GGU--AGAGCGCAUGCUUCGCAUGUAUGAG-------------------GCCCCGGGUUCGAUCCCCGGCAUCUCCACCA .(((((((..((((...........)))).(((((.......)))))........................(((((.......)))))))))))).... |
| Publications: |
|
| Comments: | Sequence obtained from hydro-tRNAseq; modified nucleosides were not determined by MS, only predicted by mismatches frequency; relative abundance among tRNAAla in HEK293 cells: 1.1% |
Aminoacylation
| Name | Value |
|---|---|
| Positive identity elements regulating aminoacylation: | G3-U70 |
| Negative identity elements antideterminants of aminoacylation: | NA |
| Citation: | Hou,Y.M. and Schimmel,P. (1989) Evidence that a major determinant for the identity of a transfer RNA is conserved in evolution. Biochemistry, 28, 6800–6804. |
| DOI: | 10.1021/bi00443a003 |
| PMID: | 2684266 |
Secondary structure
Tertiary structure
Model based on:
