We are using technical cookies that are necessary for page to work correctly.

tdbR00000648

NameValue
Coding AA: Cys
Anticodon sequence: GCA
Organism: Homo sapiens NCBI:txid9606
RNA type: cytoplasmic
Sequence: GGGGGUAUAGCUCAGGGGUAGAGCAUUUGACUGCAGAUCAAGAGGUCUCUGGUUCAAAUCCAGGUGCCCCCUCCA
Unmodified sequence: GGGGGUAUAGCUCAGGGGUAGAGCAUUUGACUGCAGAUCAAGAGGUCUCUGGUUCAAAUCCAGGUGCCCCCUCCA
Secondary structure: (((((((..((((.......)))).(((((.......))))).....(((((.......))))))))))))....
Homology model or
structure extracted from PDB:
Model Download (by RNA Composer) (last update July 2, 2025)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: May 30, 2019, modified: July 2, 2025
Folding free energy [kcal/mol]: -22.00
Pre-aligned sequence:
Pre-aligned secondary structure:
-GGGGGUAUAGCUCAGG--GGU--AGAGCAUUUGACUGCAGAUCAAGAG-------------------GUCUCUGGUUCAAAUCCAGGUGCCCCCUCCA
.(((((((..((((...........)))).(((((.......)))))........................(((((.......))))))))))))....
Variants & Diseases:
Publications:
  • Characterizing Expression and Processing of Precursor and Mature Human tRNAs by Hydro-tRNAseq and PAR-CLIP.
    Tasos Gogakos, Miguel Brown, Aitor Garzia, Cindy Meyer, Markus Hafner, Thomas Tuschl
    Cell reports
    volume: 20 issue: 6 date: Aug. 8, 2017 PUBMED ID: 28793268 DOI: 10.1016/j.celrep.2017.07.029
Comments: Sequence obtained from hydro-tRNAseq; modified nucleosides were not determined by MS, only predicted by mismatches frequency; relative abundance among tRNACys in HEK293 cells: 2.0%

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
RNA Composer