tdbR00000670
| Name | Value |
|---|---|
| Coding AA: | Phe |
| Anticodon sequence: | GAA |
| Organism: | Homo sapiens NCBI:txid9606 |
| RNA type: | cytoplasmic |
| Sequence: | GCCGAAAUAGCUCAGUUGGGAGAGCGUUAGACUGAAGAUCUAAAGGUCCCUGGUUCAAUCCCGGGUUUCGGCACCA |
| Unmodified sequence: | GCCGAAAUAGCUCAGUUGGGAGAGCGUUAGACUGAAGAUCUAAAGGUCCCUGGUUCAAUCCCGGGUUUCGGCACCA |
| Secondary structure: | (((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).... |
| Homology model or structure extracted from PDB: |
Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025) |
| Prepared by: | Database creators |
| Version: | 1 (Sept. 6, 2019), created: May 30, 2019, modified: June 29, 2026 |
| Folding free energy [kcal/mol]: | -21.90 |
| Pre-aligned sequence: Pre-aligned secondary structure: |
-GCCGAAAUAGCUCAGUU-GGG--AGAGCGUUAGACUGAAGAUCUAAAG-------------------GUCCCUGGUUCAAUCCCGGGUUUCGGCACCA .(((((((..((((...........)))).(((((.......)))))........................(((((.......)))))))))))).... |
| Variants & Diseases: | |
| Publications: |
|
| Comments: | Sequence obtained from hydro-tRNAseq; modified nucleosides were not determined by MS, only predicted by mismatches frequency; relative abundance among tRNAPhe in HEK293 cells: 34.7% |
Aminoacylation
| Name | Value |
|---|---|
| Positive identity elements regulating aminoacylation: | A73; G34; A35; A36; additional core/anticodon branch determinants |
| Negative identity elements antideterminants of aminoacylation: | NA |
| Citation: | Nazarenko,I.A., Peterson,E.T., Zakharova,O.D., Lavrik,O.I. and Uhlenbeck,O.C. (1992) Recognition nucleotides for human phenylalanyl-tRNA synthetase. Nucleic Acids Res., 20, 475–478. |
| DOI: | 10.1093/nar/20.3.475 |
| PMID: | 1741281 |
Secondary structure
Tertiary structure
Model based on:
