tdbR00000694
| Name | Value |
|---|---|
| Coding AA: | Lys |
| Anticodon sequence: | UUU |
| Organism: | Homo sapiens NCBI:txid9606 |
| RNA type: | cytoplasmic |
| Sequence: | GCCCGGAUAGCUCAGUCGGUAGAGCAUCAGACUUUUAAUCUGAGGGUCCAGGGNUCAHGUCCCUGUUCGGGCGCCA |
| Unmodified sequence: | GCCCGGAUAGCUCAGUCGGUAGAGCAUCAGACUUUUAAUCUGAGGGUCCAGGGUUCAAGUCCCUGUUCGGGCGCCA |
| Secondary structure: | (((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).... |
| Homology model or structure extracted from PDB: |
Model Download (by RNA Composer) (last update July 2, 2025) |
| Prepared by: | Database creators |
| Version: | 1 (Sept. 6, 2019), created: May 30, 2019, modified: June 29, 2026 |
| Folding free energy [kcal/mol]: | -27.50 |
| Pre-aligned sequence: Pre-aligned secondary structure: |
-GCCCGGAUAGCUCAGUC-GGU--AGAGCAUCAGACUUUUAAUCUGAGG-------------------GUCCAGGGNUCAHGUCCCUGUUCGGGCGCCA .(((((((..((((...........)))).(((((.......)))))........................(((((.......)))))))))))).... |
| Publications: |
|
| Comments: | Sequence obtained from hydro-tRNAseq; modified nucleosides were not determined by MS, only predicted by mismatches frequency; relative abundance among tRNALys in HEK293 cells: 18.8% |
Aminoacylation
| Name | Value |
|---|---|
| Positive identity elements regulating aminoacylation: | acceptor-stem/anticodon domain continuity; mammalian LysRS identity elements |
| Negative identity elements antideterminants of aminoacylation: | NA |
| Citation: | Francin,M. and Mirande,M. (2006) Identity elements for specific aminoacylation of a tRNA by mammalian lysyl-tRNA synthetase bearing a nonspecific tRNA-interacting factor. Biochemistry, 45, 10153–10160. |
| DOI: | 10.1021/bi0606905 |
| PMID: | 16906773 |
Secondary structure
Tertiary structure
Model based on:
