We are using technical cookies that are necessary for page to work correctly.

tdbR00000704

NameValue
Coding AA: Lys
Anticodon sequence: UUU
Organism: Homo sapiens NCBI:txid9606
RNA type: cytoplasmic
Sequence: GCCUGGAUAGCUCAGUCGGUAGAGCAUCAGACUUUUAAUCUGAGGGUCCAGGGUUCAAGUCCCUGUUCAGGCGCCA
Unmodified sequence: GCCUGGAUAGCUCAGUCGGUAGAGCAUCAGACUUUUAAUCUGAGGGUCCAGGGUUCAAGUCCCUGUUCAGGCGCCA
Secondary structure: (((((((..((((........)))).(((((.......))))).....(((((.......))))))))))))....
Homology model or
structure extracted from PDB:
Model Download (by RNA Composer) (last update July 2, 2025)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: May 30, 2019, modified: Aug. 26, 2026
Folding free energy [kcal/mol]: -26.00
Pre-aligned sequence:
Pre-aligned secondary structure:
-GCCUGGAUAGCUCAGUC-GGU--AGAGCAUCAGACUUUUAAUCUGAGG-------------------GUCCAGGGUUCAAGUCCCUGUUCAGGCGCCA
.(((((((..((((...........)))).(((((.......)))))........................(((((.......))))))))))))....
Publications:
  • Characterizing Expression and Processing of Precursor and Mature Human tRNAs by Hydro-tRNAseq and PAR-CLIP.
    Tasos Gogakos, Miguel Brown, Aitor Garzia, Cindy Meyer, Markus Hafner, Thomas Tuschl
    Cell reports
    volume: 20 issue: 6 date: Aug. 8, 2017 PUBMED ID: 28793268 DOI: 10.1016/j.celrep.2017.07.029
Comments: Sequence obtained from hydro-tRNAseq; modified nucleosides were not determined by MS, only predicted by mismatches frequency; relative abundance among tRNALys in HEK293 cells: 1.9%

Aminoacylation

NameValue
Positive identity elements regulating aminoacylation: acceptor-stem/anticodon domain continuity; mammalian LysRS identity elements
Negative identity elements antideterminants of aminoacylation: NA
Citation: Francin,M. and Mirande,M. (2006) Identity elements for specific aminoacylation of a tRNA by mammalian lysyl-tRNA synthetase bearing a nonspecific tRNA-interacting factor. Biochemistry, 45, 10153–10160.
DOI: 10.1021/bi0606905
PMID: 16906773

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
RNA Composer