We are using technical cookies that are necessary for page to work correctly.

tdbR00000706

NameValue
Coding AA: Leu
Anticodon sequence: IAG
Organism: Homo sapiens NCBI:txid9606
RNA type: cytoplasmic
Sequence: GGUAGCGUGGCCGAGCGGUCUAAGGC;CUGGAUUIAGGCUCCAGUCUCUUCGGGGGCGUGGGUUCGHAUCCCACCGCUGCCACCA
Unmodified sequence: GGUAGCGUGGCCGAGCGGUCUAAGGCGCUGGAUUAAGGCUCCAGUCUCUUCGGGGGCGUGGGUUCGAAUCCCACCGCUGCCACCA
Secondary structure: (((((((..(((...........)))((((((.......))))))............(((((.......))))))))))))....
Homology model or
structure extracted from PDB:
Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: May 30, 2019, modified: July 2, 2025
Folding free energy [kcal/mol]: -30.10
Pre-aligned sequence:
Pre-aligned secondary structure:
-GGUAGCGUGGCCGAGC--GGUCUAAGGC;CUGGAUUIAGGCUCCAGUCUCU-----UCG-----GGGG-CGUGGGUUCGHAUCCCACCGCUGCCACCA
.(((((((..(((.............)))((((((.......)))))).......................(((((.......))))))))))))....
Publications:
  • Characterizing Expression and Processing of Precursor and Mature Human tRNAs by Hydro-tRNAseq and PAR-CLIP.
    Tasos Gogakos, Miguel Brown, Aitor Garzia, Cindy Meyer, Markus Hafner, Thomas Tuschl
    Cell reports
    volume: 20 issue: 6 date: Aug. 8, 2017 PUBMED ID: 28793268 DOI: 10.1016/j.celrep.2017.07.029
  • Inosine modifications in human tRNAs are incorporated at the precursor tRNA level.
    Adrian Gabriel Torres, David Piñeyro, Marta Rodríguez-Escribà, Noelia Camacho, Oscar Reina, Adélaïde Saint-Léger, Liudmila Filonava, Eduard Batlle, Lluís Ribas de Pouplana
    Nucleic acids research
    volume: 43 issue: 10 date: May 26, 2015 epub: April 27, 2015 PUBMED ID: 25916855 DOI: 10.1093/nar/gkv277
Comments: Sequence obtained from hydro-tRNAseq; modified nucleosides were not determined by MS, only predicted by mismatches frequency; relative abundance among tRNALeu in HEK293 cells: 17.1%

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
Moderna
RNA Composer