tdbR00000401 (deprecated)

Name	Value
Coding AA:	Ser
Anticodon sequence:	GCU
Organism:	Bos taurus NCBI:txid9913
RNA type:	mitochondrial
Sequence:	GAAAAAGUAUGCAAGAACUGCU6AUUCUAUGCUCCCAUAUCUAAUAGUAUGGCUUUUUCGCCA
Unmodified sequence:	GAAAAAGUAUGCAAGAACUGCUAAUUCUAUGCUCCCAUAUCUAAUAGUAUGGCUUUUUCGCCA
Secondary structure:	(((((((....((.(((.......))).))...(((((.......))))))))))))....
Homology model or structure extracted from PDB:	Model Download (last update Sept. 6, 2019)
Prepared by:	Database creators
Version:	1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Sept. 22, 2019
Folding free energy [kcal/mol]:	100000.00
Pre-aligned sequence: Pre-aligned secondary structure:	-GAAAAAG-U----------------AUGCAAGAACUGCU6AUUC_UGCUC--------------------CCAUAUCUAAU_UAUGGCUUUUUCGCCA .(((((((.....................((.(((.......))).)).......................(((((.......))))))))))))....
Publications:	The nucleotide sequence of a small (3S) seryl-tRNA (anticodon GCU) from beef heart mitochondria. P Arcari, G G Brownlee Nucleic acids research volume: 8 issue: 22 date: Nov. 25, 1980 PUBMED ID: 6906661
Next entry:	tdbR00000401 (Sept. 23, 2019, 3:12 p.m.)