tdbR00000739
| Name | Value |
|---|---|
| Coding AA: | Pro |
| Anticodon sequence: | <GG |
| Organism: | Homo sapiens NCBI:txid9606 |
| RNA type: | cytoplasmic |
| Sequence: | GGCUCGUUGGUCUAGGGGNAUGAUUCUCGCUU<GGGUGNGAGAGGUCCCGGGUUCAAAUCCCGGACGAGCCCCCA |
| Unmodified sequence: | GGCUCGUUGGUCUAGGGGUAUGAUUCUCGCUUCGGGUGUGAGAGGUCCCGGGUUCAAAUCCCGGACGAGCCCCCA |
| Secondary structure: | (((((((..(((.........)))((((((.......))))))....(((((.......)))))))))))).... |
| Homology model or structure extracted from PDB: |
Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025) |
| Prepared by: | Database creators |
| Version: | 1 (Sept. 6, 2019), created: May 30, 2019, modified: June 29, 2026 |
| Folding free energy [kcal/mol]: | -27.60 |
| Pre-aligned sequence: Pre-aligned secondary structure: |
-GGCUCGUUGGUCUAGG--GGN--AUGAUUCUCGCUU<GGGUGNGAGAG-------------------GUCCCGGGUUCAAAUCCCGGACGAGCCCCCA .(((((((..(((.............)))((((((.......)))))).......................(((((.......)))))))))))).... |
| Variants & Diseases: | |
| Publications: |
|
| Comments: | Sequence obtained from hydro-tRNAseq; modified nucleosides were not determined by MS, only predicted by mismatches frequency; relative abundance among tRNAPro in HEK293 cells: 10.7% |
Aminoacylation
| Name | Value |
|---|---|
| Positive identity elements regulating aminoacylation: | C73/backbone/acceptor-stem contacts; G35; G36 |
| Negative identity elements antideterminants of aminoacylation: | NA |
| Citation: | An,S., Barany,G. and Musier-Forsyth,K. (2008) Evolution of acceptor stem tRNA recognition by class II prolyl-tRNA synthetase. Nucleic Acids Res., 36, 2514–2521. |
| DOI: | 10.1093/nar/gkn063 |
| PMID: | 18310681 |
Secondary structure
Tertiary structure
Model based on:
