tdbR00000786
| Name | Value |
|---|---|
| Coding AA: | Ser |
| Anticodon sequence: | GCU |
| Organism: | Homo sapiens NCBI:txid9606 |
| RNA type: | cytoplasmic |
| Sequence: | GACGAGGUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCACCUUCGUCGCCA |
| Unmodified sequence: | GACGAGGUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCACCUUCGUCGCCA |
| Secondary structure: | (((((((..(((..........)))((((((.......)))))).............(((((.......)))))))))))).... |
| Homology model or structure extracted from PDB: |
Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025) |
| Prepared by: | Database creators |
| Version: | 1 (Sept. 6, 2019), created: May 30, 2019, modified: Aug. 26, 2026 |
| Folding free energy [kcal/mol]: | -25.40 |
| Pre-aligned sequence: Pre-aligned secondary structure: |
-GACGAGGUGGCCGAGU--GGUU-AAGGCGAUGGACUGCUAAUCCAUUGUGC-----UCU-----GCACGCGUGGGUUCGAAUCCCACCUUCGUCGCCA .(((((((..(((.............)))((((((.......)))))).......................(((((.......)))))))))))).... |
| Publications: |
|
| Comments: | Sequence obtained from hydro-tRNAseq; modified nucleosides were not determined by MS, only predicted by mismatches frequency; relative abundance among tRNASer in HEK293 cells: 4.6% |
Aminoacylation
| Name | Value |
|---|---|
| Positive identity elements regulating aminoacylation: | G73; large variable arm |
| Negative identity elements antideterminants of aminoacylation: | Anticodon is not a major determinant. |
| Citation: | Achsel,T. and Gross,H.J. (1993) Identity determinants of human tRNASer: sequence elements necessary for serylation and maturation of a tRNA with a long extra arm. EMBO J., 12, 3333–3338. |
| DOI: | 10.1002/j.1460-2075.1993.tb06003.x |
| PMID: | 8344269 |
Secondary structure
Tertiary structure
Model based on:
