We are using technical cookies that are necessary for page to work correctly.

tdbR00000796

NameValue
Coding AA: Thr
Anticodon sequence: AGU
Organism: Homo sapiens NCBI:txid9606
RNA type: cytoplasmic
Sequence: GGCUUCGUGGCUUAGCUGGUUAAAGCGCCUGUCUAGUAAACAGGAGAUCCUGGGUUCGAAUCCCAGCGAGGCCUCCA
Unmodified sequence: GGCUUCGUGGCUUAGCUGGUUAAAGCGCCUGUCUAGUAAACAGGAGAUCCUGGGUUCGAAUCCCAGCGAGGCCUCCA
Secondary structure: (((((((..((((.........)))).(((((.......))))).....(((((.......))))))))))))....
Homology model or
structure extracted from PDB:
Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025)
Prepared by: Database creators
Version: 1 (Sept. 6, 2019), created: May 30, 2019, modified: June 29, 2026
Folding free energy [kcal/mol]: -25.20
Pre-aligned sequence:
Pre-aligned secondary structure:
-GGCUUCGUGGCUUAGCU-GGUU-AAAGCGCCUGUCUAGUAAACAGGAG-------------------AUCCUGGGUUCGAAUCCCAGCGAGGCCUCCA
.(((((((..((((...........)))).(((((.......)))))........................(((((.......))))))))))))....
Variants & Diseases:
Publications:
  • Characterizing Expression and Processing of Precursor and Mature Human tRNAs by Hydro-tRNAseq and PAR-CLIP.
    Tasos Gogakos, Miguel Brown, Aitor Garzia, Cindy Meyer, Markus Hafner, Thomas Tuschl
    Cell reports
    volume: 20 issue: 6 date: Aug. 8, 2017 PUBMED ID: 28793268 DOI: 10.1016/j.celrep.2017.07.029
Comments: Sequence obtained from hydro-tRNAseq; modified nucleosides were not determined by MS, only predicted by mismatches frequency; relative abundance among tRNAThr in HEK293 cells: 1.6%

Aminoacylation

NameValue
Positive identity elements regulating aminoacylation: G4-U69-containing vertebrate tRNAThr can be alanylated/mischarged; normal Thr identity also uses anticodon and acceptor-stem context
Negative identity elements antideterminants of aminoacylation: Alanyl-tRNAThr is prevented from mistranslation by ThrRS trans-editing.
Citation: Chen,M., Kuhle,B., Diedrich,J., Liu,Z., Moresco,J.J., Yates Iii,J.R., Pan,T. and Yang,X.-L. (2020) Cross-editing by a tRNA synthetase allows vertebrates to abundantly express mischargeable tRNA without causing mistranslation. Nucleic Acids Res., 48, 6445–6457.
DOI: 10.1093/nar/gkaa469
PMID: 32484512

Secondary structure

Your browser does not support the canvas element.

Tertiary structure

Model based on:
Moderna
RNA Composer