tdbR00000798
| Name | Value |
|---|---|
| Coding AA: | Thr |
| Anticodon sequence: | UGU |
| Organism: | Homo sapiens NCBI:txid9606 |
| RNA type: | cytoplasmic |
| Sequence: | GGCUCCAUAGCUCAGGGGUUAGAGC;CUGGUCUUGUAAACCAGGGGUCGCGAGUUCAHUUCUCGCUGGGGCCUCCA |
| Unmodified sequence: | GGCUCCAUAGCUCAGGGGUUAGAGCGCUGGUCUUGUAAACCAGGGGUCGCGAGUUCAAUUCUCGCUGGGGCCUCCA |
| Secondary structure: | (((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).... |
| Homology model or structure extracted from PDB: |
Model Download (by Moderna) Download (by RNA Composer) (last update July 2, 2025) |
| Prepared by: | Database creators |
| Version: | 1 (Sept. 6, 2019), created: May 30, 2019, modified: Aug. 26, 2026 |
| Folding free energy [kcal/mol]: | -29.40 |
| Pre-aligned sequence: Pre-aligned secondary structure: |
-GGCUCCAUAGCUCAGG--GGUU-AGAGC;CUGGUCUUGUAAACCAGGG-------------------GUCGCGAGUUCAHUUCUCGCUGGGGCCUCCA .(((((((..((((...........)))).(((((.......)))))........................(((((.......)))))))))))).... |
| Publications: |
|
| Comments: | Sequence obtained from hydro-tRNAseq; modified nucleosides were not determined by MS, only predicted by mismatches frequency; relative abundance among tRNAThr in HEK293 cells: 2.6% |
Aminoacylation
| Name | Value |
|---|---|
| Positive identity elements regulating aminoacylation: | G4-U69-containing vertebrate tRNAThr can be alanylated/mischarged; normal Thr identity also uses anticodon and acceptor-stem context |
| Negative identity elements antideterminants of aminoacylation: | Alanyl-tRNAThr is prevented from mistranslation by ThrRS trans-editing. |
| Citation: | Chen,M., Kuhle,B., Diedrich,J., Liu,Z., Moresco,J.J., Yates Iii,J.R., Pan,T. and Yang,X.-L. (2020) Cross-editing by a tRNA synthetase allows vertebrates to abundantly express mischargeable tRNA without causing mistranslation. Nucleic Acids Res., 48, 6445–6457. |
| DOI: | 10.1093/nar/gkaa469 |
| PMID: | 32484512 |
Secondary structure
Tertiary structure
Model based on:
