tdbR00000822
| Name | Value |
|---|---|
| Coding AA: | Trp |
| Anticodon sequence: | CCA |
| Organism: | Homo sapiens NCBI:txid9606 |
| RNA type: | cytoplasmic |
| Sequence: | GACCUCGUGGCGCAACGGUAGCGCGUCUGACUCCAGAUCAGAAGGCUGCGUGUUCGAAUCACGUCGGGGNCACCA |
| Unmodified sequence: | GACCUCGUGGCGCAACGGUAGCGCGUCUGACUCCAGAUCAGAAGGCUGCGUGUUCGAAUCACGUCGGGGUCACCA |
| Secondary structure: | (((((((..((((.......)))).(((((.......))))).....(((((.......)))))))))))).... |
| Homology model or structure extracted from PDB: |
Model Download (by RNA Composer) (last update July 2, 2025) |
| Prepared by: | Database creators |
| Version: | 1 (Sept. 6, 2019), created: May 30, 2019, modified: June 29, 2026 |
| Folding free energy [kcal/mol]: | -25.10 |
| Pre-aligned sequence: Pre-aligned secondary structure: |
-GACCUCGUGGCGCAAC--GGU--AGCGCGUCUGACUCCAGAUCAGAAG-------------------GCUGCGUGUUCGAAUCACGUCGGGGNCACCA .(((((((..((((...........)))).(((((.......)))))........................(((((.......)))))))))))).... |
| Variants & Diseases: | |
| Publications: |
|
| Comments: | Sequence obtained from hydro-tRNAseq; modified nucleosides were not determined by MS, only predicted by mismatches frequency; relative abundance among tRNATrp in HEK293 cells:16.9% |
Aminoacylation
| Name | Value |
|---|---|
| Positive identity elements regulating aminoacylation: | A73; G1-C72; U5-G68/G5-C68 context; C34; C35; A36 |
| Negative identity elements antideterminants of aminoacylation: | NA |
| Citation: | Xu,F., Chen,X., Xin,L., Chen,L., Jin,Y. and Wang,D. (2001) Species-specific differences in the operational RNA code for aminoacylation of tRNATrp. Nucleic Acids Res., 29, 4125–4133. |
| DOI: | 10.1093/nar/29.20.4125 |
| PMID: | 11600701 |
Secondary structure
Tertiary structure
Model based on:
