tdbR00000522

Name	Value
Coding AA:	Ini
Anticodon sequence:	>AU
Organism:	Bos taurus NCBI:txid9913
RNA type:	mitochondrial
Sequence:	AGUAAGGUCAGCUAAUUAAGCUAPCGGGCC>AUACCCCGAAAAUGPUGGUUUAUAUCCUUCCCGUACUACCA
Unmodified sequence:	AGUAAGGUCAGCUAAUUAAGCUAUCGGGCCCAUACCCCGAAAAUGUUGGUUUAUAUCCUUCCCGUACUACCA
Secondary structure:	((((.((..((((.....)))).(((((.......)))))....(..((.......))..))).))))....
Homology model or structure extracted from PDB:	Model Download (last update Sept. 6, 2019)
Prepared by:	Database creators
Version:	1 (Sept. 6, 2019), created: Feb. 25, 2019, modified: Sept. 23, 2019
Folding free energy [kcal/mol]:	-12.60
Pre-aligned sequence: Pre-aligned secondary structure:	-AGUAAGGUCAGCUAAUU------AAGCUAPCGGGCC>AUACCCCGAAA-------------------A-UGPUGGUUUAUAUCCUUCCCGUACUACCA .((((.((..((((...........)))).(((((.......)))))........................(..((.......))..))).))))....
Publications:	Sequence and structure of a methionine transfer RNA from mosquito mitochondria. D T Dubin, C C HsuChen Nucleic acids research volume: 12 issue: 10 date: May 25, 1984 PUBMED ID: 6328414 A novel modified nucleoside found at the first position of the anticodon of methionine tRNA from bovine liver mitochondria. J Moriya, T Yokogawa, K Wakita, T Ueda, K Nishikawa, P F Crain, T Hashizume, S C Pomerantz, J A McCloskey, G Kawai Biochemistry volume: 33 issue: 8 date: March 1, 1994 PUBMED ID: 7509636

Your browser does not support the canvas element.